RMgmDB - Rodent Malaria genetically modified Parasites

Summary

RMgm-599
Malaria parasiteP. berghei
Genotype
DisruptedGene model (rodent): PBANKA_1125100; Gene model (P.falciparum): PF3D7_0626300; Gene product: 3-oxoacyl-acyl-carrier protein synthase I/II (FabB/F)
Transgene
Transgene not Plasmodium: A fusion of GFP (gfp-mu3) and Luciferase Firefly (LucIAV)
Promoter: Gene model: PBANKA_1133300; Gene model (P.falciparum): PF3D7_1357100; Gene product: elongation factor 1-alpha (eef1a)
3'UTR: Gene model: PBANKA_0719300; Gene product: bifunctional dihydrofolate reductase-thymidylate synthase, putative (dhfr/ts)
Replacement locus: Gene model: PBANKA_0306000; Gene product: 6-cysteine protein (230p)
Phenotype Sporozoite; Liver stage;
Last modified: 2 September 2015, 07:29
  *RMgm-599
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene disruption, Introduction of a transgene
Reference (PubMed-PMID number) Reference 1 (PMID number) : 22342550
MR4 number
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone P. berghei ANKA 676m1cl1 (RMgm-29)
Other information parent line676m1cl1 (RMgm-29) is a reference ANKA mutant line which expresses GFP-luciferase under control of a constitutive promoter. This reference line does not contain a drug-selectable marker (PubMed: PMID: 16242190).
The mutant parasite was generated by
Name PI/ResearcherT. Annoura; C.J. Janse; S.M. Khan
Name Group/DepartmentLeiden Malaria Research Group
Name InstituteLeiden University Medical Center
CityLeiden
CountryThe Netherlands
Name of the mutant parasite
RMgm numberRMgm-599
Principal name1704cl1
Alternative name∆fabb/f
Standardized name
Is the mutant parasite cloned after genetic modificationYes
Phenotype
Asexual blood stageNot different from wild type
Gametocyte/GameteNot different from wild type
Fertilization and ookineteNot different from wild type
OocystNot different from wild type
SporozoiteNormal numbers of salivary gland sporozoites are formed. Sporozoites have a reduced infectivity to mice as shown by a significant delay of blood infections (prolonged prepatent period) after intravenous inoculation of sporozoites.
Liver stageNormal numbers of salivary gland sporozoites are formed. Sporozoites have a reduced infectivity to mice as shown by a significant delay of blood infections (prolonged prepatent period) after intravenous inoculation of sporozoites.
Sporozoites showed normal cell traversal, hepatocyte invasion rates and initial stages of intrahepatic development. The formation of merozoites within the liver schizonts was affected (see 'Additional information'). Intravenous injection of 50.000 sporozoites resulted in breakthrough blood infections in the majority (80–100%) of BALB/c mice. All C57BL/6 mice developed a blood stage infection when infected with 50.000 sporozoites. The blood infections show a prolonged prepatency period of 1–2 days as compared to WT parasites. Assuming a P. berghei blood stage multiplication rate of 10× per 24 h this delay to patency indicates a 90–99% reduction in the production and/or infectivity of the Δfabb/f exo-erythrocytic merozoites.
Additional remarks phenotype

Mutant/mutation
The mutant lacks expression of FABB/F and expresses the fusion protein GFP-luciferase under the constitutive eef1α promoter.

Protein (function)
FABB/F is an enzyme of the bacterial like type II fatty acid biosynthesis (FAS-II) pathway. In Plasmodium

FAS-II enzymes have been localized to the apicoplast, a nonphotosynthetic plastid organelle of cyanobacterial origin.

FAS-II requires acetyl-Coenzyme A (CoA), which can be converted from pyruvate by the pyruvate dehydrogenase complex. Acetyl-CoA carboxylase converts acetyl-CoA to malonyl-CoA, which is tethered to an acyl carrier protein (ACP) by malonyl-CoA:ACP transacylase (FabD). This produces malonyl-ACP, which, in conjunction with acetyl-CoA, is acted upon by β-ketoacyl-ACP synthase III (Fab H) to form β-ketoacyl-ACP. This precursor enters the FAS-II elongation cycle, mediated by FabB/F (β-ketoacyl-acyl-carrier-protein (ACP) synthase), FabG (β-ketoacyl-ACP reductase), FabZ/A (β-hydroxyacyl-ACP dehydratase), and FabI (trans-2-enoyl-ACP reductase). These four FAS-II enzymes iteratively catalyze the addition of two carbon chains to a growing fatty acyl carbon chain via condensation, reduction, dehydration, and reduction steps, respectively.

Phenotype
The phenotype analyses show that FABB/F is not essential for blood stage development, mosquito stage development and initial infection of the liver. The results indicate an important (but not essential role) in the formation of infective liver stage merozoites demonstrating the importance of FASII pathway for synthesis of fatty acids during late liver stage development. Intravenous injection of 50.000 sporozoites  resulted in breakthrough blood infections in the majority (80–100%) of BALB/c mice. All C57BL/6 mice developed a blood stage infection when infected with 50.000 sporozoites. The blood infections show a prolonged prepatency period of 1–2 days as compared to WT parasites. Assuming a P. berghei

blood stage multiplication rate of 10× per 24 h this delay to patency indicates a 90–99% reduction in the production and/or infectivity of the Δfabb/f exo-erythrocytic merozoites.

Additional information
Liver stages of Δfabb/f developed into mature forms as shown by qRT-PCR analysis and immuno-fluorescence microscopy. During in vitro liver stage development, the Δfabb/f parasites were morphologically similar to WT parasites as judged by immuno-fluorescence microscopy. However, schizonts showed a significantly lower level of expression of the merozoite surface protein 1 (MSP1); at 48 h post infection (hpi) only 18% of the Δfabb/f schizonts strongly expressed MSP1 whereas 39% of WT parasites were MSP1-positive (p < 0.001) and this increased to 54% in WT and 37% in Δfabb/f at 54 hpi (p = 0.01). The normal morphology of maturing Δfabb/f liver stages and expression of MSP1 parasites is different from the phenotype reported for P. yoelii

parasites lacking expression of FabB/F (RMgm-183), where schizonts show clear signs of degeneration and absence of MSP1 expression.

Other mutants

RMgm-598: An independent P. berghei mutant lacking expression of FabB/F.
RMgm-183 : A P. yoelii mutant lacking expression of FabB/F.
RMgm-180: A P. yoelii mutant expressing myc tagged FABI
RMgm-181: A P. yoelii mutant expressing myc tagged FABZ
RMgm-182: A P. yoelii mutant expressing myc tagged FABG
RMgm-184: A P. yoelii mutant lacking expression of FABz
RMgm-197: A P. berghei mutant lacking expression ofFABI


  Disrupted: Mutant parasite with a disrupted gene
Details of the target gene
Gene Model of Rodent Parasite PBANKA_1125100
Gene Model P. falciparum ortholog PF3D7_0626300
Gene product3-oxoacyl-acyl-carrier protein synthase I/II
Gene product: Alternative nameFabB/F
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct used(Linear) PCR construct double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid Asp718, ScaI
Partial or complete disruption of the geneComplete
Additional remarks partial/complete disruption
Selectable marker used to select the mutant parasitehdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modificationThe mutant was generated by disruption of the gene using a linear construct that was generated using a 2-step, anchor tagging PCR method (for primer details see below).

The 5’- and 3’ targeting regions of the gene were PCR amplified from genomic DNA using primer pairs 1&2 and 3&4. Primers 2 and 3 have 5’-terminal extensions homologues to the hDHFR selectable marker cassette. Primers 1 and 4 both have a 5’-terminal overhang with an anchor-tag which serves as a primer site in the 2nd PCR reaction.

The target fragments from the first PCR reaction were annealed to either side of the selectable marker cassette by PCR with anchor-tag primers 5 and 6, resulting in the 2nd PCR product. The hDHFR selectable marker cassette used in this reaction was digested from pL0040 using restriction enzymes XhoI and NotI. pL0040 is available from The Leiden Malaria Research Group.

To remove the anchor-tags from the final KO construct, and to eliminate contaminating pL0040, the 2nd PCR product was digested with Asp718/ScaI and DpnI respectively. DpnI only cuts methylated plasmid DNA but not the PCR product.
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1GAACTCGTACTCCTTGGTGACGGTACCGGTAATGGATGTGTACACAAAAG
Additional information primer 1L5804 (Asp718); 5' targeting region
Sequence Primer 2CATCTACAAGCATCGTCGACCTCCACACTGTATACAGGACACTTG
Additional information primer 2L5804; 5' targeting region
Sequence Primer 3CCTTCAATTTCGGATCCACTAGCATGGCATCTTTCTCGCACAC
Additional information primer 3L5804; 3' targeting region
Sequence Primer 4AGGTTGGTCATTGACACTCAGCAGTACTTGATAACCTATGCACTCAAGG
Additional information primer 4L5804 (ScaI); 3' targeting region
Sequence Primer 5GAACTCGTACTCCTTGGTGACG
Additional information primer 5anchor-tag
Sequence Primer 6AGGTTGGTCATTGACACTCAGC
Additional information primer 6anchor-tag

  Transgene: Mutant parasite expressing a transgene
Type and details of transgene
Is the transgene Plasmodium derived Transgene: not Plasmodium
Transgene nameA fusion of GFP (gfp-mu3) and Luciferase Firefly (LucIAV)
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct(Linear) plasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Click to view information
Click to hide information
Plasmid/construct sequence
Click to view information
Click to hide information
1 aattcactgg ccgtcgtttt acaacgtcgt gactgggaaa accctggcgt tacccaactt
61 aatcgccttg cagcacatcc ccctttcgcc agctggcgta atagcgaaga ggcccgcacc
121 gatcgccctt cccaacagtt gcgcagcctg aatggcgaat ggcgcctgat gcggtatttt
181 ctccttacgc atctgtgcgg tatttcacac cgcatatggt gcactctcag tacaatctgc
241 tctgatgccg catagttaag ccagccccga cacccgccaa cacccgctga cgcgccctga
301 cgggcttgtc tgctcccggc atccgcttac agacaagctg tgaccgtctc cgggagctgc
361 atgtgtcaga ggttttcacc gtcatcaccg aaacgcgcga gacgaaaggg cctcgtgata
421 cgcctatttt tataggttaa tgtcatgata ataatggttt cttagacgtc aggtggcact
481 tttcggggaa atgtgcgcgg aacccctatt tgtttatttt tctaaataca ttcaaatatg
541 tatccgctca tgagacaata accctgataa atgcttcaat aatattgaaa aaggaagagt
601 atgagtattc aacatttccg tgtcgccctt attccctttt ttgcggcatt ttgccttcct
661 gtttttgctc acccagaaac gctggtgaaa gtaaaagatg ctgaagatca gttgggtgca
721 cgagtgggtt acatcgaact ggatctcaac agcggtaaga tccttgagag ttttcgcccc
781 gaagaacgtt ttccaatgat gagcactttt aaagttctgc tatgtggcgc ggtattatcc
841 cgtattgacg ccgggcaaga gcaactcggt cgccgcatac actattctca gaatgacttg
901 gttgagtact caccagtcac agaaaagcat cttacggatg gcatgacagt aagagaatta
961 tgcagtgctg ccataaccat gagtgataac actgcggcca acttacttct gacaacgatc
1021 ggaggaccga aggagctaac cgcttttttg cacaacatgg gggatcatgt aactcgcctt
1081 gatcgttggg aaccggagct gaatgaagcc ataccaaacg acgagcgtga caccacgatg
1141 cctgtagcaa tggcaacaac gttgcgcaaa ctattaactg gcgaactact tactctagct
1201 tcccggcaac aattaataga ctggatggag gcggataaag ttgcaggacc acttctgcgc
1261 tcggcccttc cggctggctg gtttattgct gataaatctg gagccggtga gcgtgggtct
1321 cgcggtatca ttgcagcact ggggccagat ggtaagccct cccgtatcgt agttatctac
1381 acgacgggga gtcaggcaac tatggatgaa cgaaatagac agatcgctga gataggtgcc
1441 tcactgatta agcattggta actgtcagac caagtttact catatatact ttagattgat
1501 ttaaaacttc atttttaatt taaaaggatc taggtgaaga tcctttttga taatctcatg
1561 accaaaatcc cttaacgtga gttttcgttc cactgagcgt cagaccccgt agaaaagatc
1621 aaaggatctt cttgagatcc tttttttctg cgcgtaatct gctgcttgca aacaaaaaaa
1681 ccaccgctac cagcggtggt ttgtttgccg gatcaagagc taccaactct ttttccgaag
1741 gtaactggct tcagcagagc gcagatacca aatactgtcc ttctagtgta gccgtagtta
1801 ggccaccact tcaagaactc tgtagcaccg cctacatacc tcgctctgct aatcctgtta
1861 ccagtggctg ctgccagtgg cgataagtcg tgtcttaccg ggttggactc aagacgatag
1921 ttaccggata aggcgcagcg gtcgggctga acggggggtt cgtgcacaca gcccagcttg
1981 gagcgaacga cctacaccga actgagatac ctacagcgtg agcattgaga aagcgccacg
2041 cttcccgaag ggagaaaggc ggacaggtat ccggtaagcg gcagggtcgg aacaggagag
2101 cgcacgaggg agcttccagg gggaaacgcc tggtatcttt atagtcctgt cgggtttcgc
2161 cacctctgac ttgagcgtcg atttttgtga tgctcgtcag gggggcggag cctatggaaa
2221 aacgccagca acgcggcctt tttacggttc ctggcctttt gctggccttt tgctcacatg
2281 ttctttcctg cgttatcccc tgattctgtg gataaccgta ttaccgcctt tgagtgagct
2341 gataccgctc gccgcagccg aacgaccgag cgcagcgagt cagtgagcga ggaagcggaa
2401 gagcgcccaa tacgcaaacc gcctctcccc gcgcgttggc cgattcatta atgcagctgg
2461 cacgacaggt ttcccgactg gaaagcgggc agtgagcgca acgcaattaa tgtgagttag
2521 ctcactcatt aggcacccca ggctttacac tttatgcttc cggctcgtat gttgtgtgga
2581 attgtgagcg gataacaatt tcacacagga aacagctatg accatgatta cgccaagctt
2641 ccgcgggtat atggtaaaga acctactaac acaataaaat atttaaataa tgtatttcct
2701 ataaataaat ttacagattt attttttaat acaaaagata tagatatacc agaaataaat
2761 gatcagttta aaggttttaa attctttatg acatcattta taaatcatgg atcatatcca
2821 ctaacaatag aatgtggtgt aacaaatggt ggaactagtt ataaaagagc aattatttta
2881 ttgcatgttc gaactgattt aaaagataga ccagtttcat tttgtgattt tcgaaaagga
2941 gaattatata attatttgaa tgcttatact gaaggggatg tatgcataat aatttccaaa
3001 tcaaatacaa gttttggttt tagatgccca gtaaatacaa aaaaaatgcc aaaaaattgt
3061 tttacgcaag tatatgaaaa agggtatcta aatgacgcca ataaaattaa tactaaaaat
3121 gttattaact attcatttga aaatccagaa tatgcgctag ctggttytaa ttatacatta
3181 acaaaatcgt atcaatttga atgtcattgt gtagataaag aaacagaaca aattgtaaaa
3241 acggttttag tcaaatatgt aaatgaagat gaaatatatg attataatga ttttccaatg
3301 gtgaatcaca aacctattat tgcacatcca aataaaacac atcaagcttg catgcctgca
3361 gcccagctta attcttttcg agctctttat gcttaagttt acaatttaat attcatactt
3421 taagtatttt ttgtagtatc ctagatattg tgctttaaat gctcacccct caaagcacca
3481 gtaatatttt catccactga aataccatta aattttcaaa aaaatactat gcatataatg
3541 ttatacatat aaacataaaa cgccatgtaa atcaaaaaat atataaaaat atgtataaaa
3601 ataaatatgc actaaatata agctaattat gcataaaaat taaagtgccc tttattaact
3661 agtcgtaatt atttatattt ctatgttata aaaaaatcct catataataa tataattaat
3721 atatgtaatg ttttttttat tttataattt taatataaaa taatatgtaa attaattcaa
3781 aaaataaata taattgttgt gaaacaaaaa acgtaatttt ttcatttgcc ttcaaaattt
3841 aaatttattt taatatttcc taaaatatat atactttgtg tataaatata taaaaatata
3901 tatttgctta taaataaata aaaaatttta taaaacatag ggggatctat gagtaaagga
3961 gaagaacttt tcactggagt tgtcccaatt cttgttgaat tagatggtga tgttaatggg
4021 cacaaatttt ctgtcagtgg agagggtgaa ggtgatgcaa catacggaaa acttaccctt
4081 aaatttattt gcactactgg aaaactacct gttccatggc caacacttgt cactactttc
4141 ggttatggtg ttcaatgctt tgcgagatac ccagatcata tgaaacagca tgactttttc
4201 aagagtgcca tgcccgaagg ttatgtacag gaaagaacta tatttttcaa agatgacggg
4261 aactacaaga cacgtgctga agtcaagttt gaaggtgata cccttgttaa tagaatcgag
4321 ttaaaaggta ttgattttaa agaagatgga aacattcttg gacacaaatt ggaatacaac
4381 tataactcac acaatgtata catcatggca gacaaacaaa agaatggaat caaagttaac
4441 ttcaaaatta gacacaacat tgaagatgga agcgttcaac tagcagacca ttatcaacaa
4501 aatactccaa ttggcgatgg ccctgtcctt ttaccagaca accattacct gtccacacaa
4561 tctgcccttt cgaaagatcc caacgaaaag agagaccaca tggtccttct tgagtttgta
4621 acagctgctg ggattacaca tggcatggat gaactataca aagggatcct ggctagccag
4681 tcgacctgca ggcatgcaag cttgcggccg atccaaatgg aagacgccaa aaacataaag
4741 aaaggcccgg cgccattcta tccgctggaa gatggaaccg ctggagagca actgcataag
4801 gctatgaaga gatacgccct ggttcctgga acaattgctt ttacagatgc acatatcgag
4861 gtgaacatca cgtacgcgga atacttcgaa atgtccgttc ggttggcaga agctatgaaa
4921 cgatatgggc tgaatacaaa tcacagaatc gtcgtatgca gtgaaaactc tcttcaattc
4981 tttatgccgg tgttgggcgc gttatttatc ggagttgcag ttgcgcccgc gaacgacatt
5041 tataatgaac gtgaattgct caacagtatg aacatttcgc agcctaccgt agtgtttgtt
5101 tccaaaaagg ggttgcaaaa aattttgaac gtgcaaaaaa aattaccaat aatccagaaa
5161 attattatca tggattctaa aacggattac cagggatttc agtcgatgta cacgttcgtc
5221 acatctcatc tacctcccgg ttttaatgaa tacgattttg taccagagtc ctttgatcgt
5281 gacaaaacaa ttgcactgat aatgaattcc tctggatcta ctgggttacc taagggtgtg
5341 gcccttccgc atagaactgc ctgcgtcaga ttctcgcatg ccagagatcc tatttttggc
5401 aatcaaatca ttccggatac tgcgatttta agtgttgttc cattccatca cggttttgga
5461 atgtttacta cactcggata tttgatatgt ggatttcgag tcgtcttaat gtatagattt
5521 gaagaagagc tgtttttacg atcccttcag gattacaaaa ttcaaagtgc gttgctagta
5581 ccaaccctat tttcattctt cgccaaaagc actctgattg acaaatacga tttatctaat
5641 ttacacgaaa ttgcttctgg gggcgcacct ctttcgaaag aagtcgggga agcggttgca
5701 aaacgcttcc atcttccagg gatacgacaa ggatatgggc tcactgagac tacatcagct
5761 attctgatta cacccgaggg ggatgataaa ccgggcgcgg tcggtaaagt tgttccattt
5821 tttgaagcga aggttgtgga tctggatacc gggaaaacgc tgggcgttaa tcagagaggc
5881 gaattatgtg tcagaggacc tatgattatg tccggttatg taaacaatcc ggaagcgacc
5941 aacgccttga ttgacaagga tggatggcta cattctggag acatagctta ctgggacgaa
6001 gacgaacact tcttcatagt tgaccgcttg aagtctttaa ttaaatacaa aggatatcag
6061 gtggcccccg ctgaattgga atcgatattg ttacaacacc ccaacatctt cgacgcgggc
6121 gtggcaggtc ttcccgacga tgacgccggt gaacttcccg ccgccgttgt tgttttggag
6181 cacggaaaga cgatgacgga aaaagagatc gtggattacg tcgccagtca agtaacaacc
6241 gcgaaaaagt tgcgcggagg agttgtgttt gtggacgaag taccgaaagg tcttaccgga
6301 aaactcgacg caagaaaaat cagagagatc ctcataaagg ccaagaaggg cggaaagatc
6361 gccgtgtaat tctagaagat cccgtttttc ttacttatat atttatacca attgattgta
6421 tttataactg taaaaatgtg tatgttgtgt gcatattttt ttttgtgcat gcacatgcat
6481 gtaaatagct aaaattatga acattttatt ttttgttcag aaaaaaaaaa ctttacacac
6541 ataaaatggc tagtatgaat agccatattt tatataaatt aaatcctatg aatttatgac
6601 catattaaaa atttagatat ttatggaaca taatatgttt gaaacaataa gacaaaatta
6661 ttattattat tattattttt actgttataa ttatgttgtc tcttcaatga ttcataaata
6721 gttggacttg atttttaaaa tgtttataat atgattagca tagttaaata aaaaaagttg
6781 aaaaattaaa aaaaaacata taaacacaaa tgatgttttt tccttcaatt tcgggtaccg
6841 agctcgaatt ctcttgagcc cgttaatgaa atagatacaa ttcattcatg ttatatacat
6901 ctagaacata atctgaatat ggttcaagtt aaatgtccaa aaattataaa aagtgatgat
6961 atttttgatg gtaataccat aatagacacc aaggtaacat cacgaagtag tcaacaaaat
7021 aatttttatt tagaaaatac agatgttgaa ccagaagaaa tagagaaata taaaaatata
7081 gaatacatac cagaaaacga tgaagtaatg catctagaca aaaaagaaaa gctagatgat
7141 atattaccag gtgttatcat attagataaa aataaaatgt tcaaagaaaa aggacatttc
7201 acttttgtta ctccattaat tgtagaaaag gtattaatat taaaaatata ttgtgataat
7261 actaaaacaa taattaataa tatgaaaggg aaaaaaggta ttacagtaat aaggatttct
7321 caaaatacaa caaaaaataa attttatgga tgtgactttt caggtaattc taaaaaaaca
7381 ttttactatt ccaatgttta tgatttagaa aaaaaaaatg agttttgtga aatagaatta
7441 aaagaaaata tagtagttag cttaaattgt ccaactggta aaattaatcc aaaaaattgt
7501 tttagaaatg tatatataaa aagtaatatg aatgaacaaa caaccgaaaa tatagaaaat
7561 atatttaacg aaataaaagt tatagatgca gattatttta taaataattc atcaaccttt
7621 ttgatgattt ccaaaattac aaaaaaagag tttgattttt attgtacatg tgaagattat
7681 aaaaccaaaa atataggaac aatatatatt aaaaattatg aatatctaga ttcaaaacct
7741 aaatataaaa ataaacaaat ttcctatata gatgtagttc catacccgcg gggaaagggc
7801 g
Restriction sites to linearize plasmid ApaI, SacII
Selectable marker used to select the mutant parasitegfp (FACS)
Promoter of the selectable markereef1a
Selection (positive) procedureFACS (flowsorting)
Selection (negative) procedureNo
Additional remarks genetic modificationThe GFP-Luciferase gene (1 copy) has been inserted into the 230p locus (PBANKA_030600) by double cross-over integration.
Additional remarks selection procedure
Other details transgene
Promoter
Gene Model of Parasite PBANKA_1133300
Gene Model P. falciparum ortholog PF3D7_1357100
Gene productelongation factor 1-alpha
Gene product: Alternative nameeef1a
Primer information details of the primers used for amplification of the promoter sequence  Click to view information
Primer information details of the primers used for amplification of the promoter sequence  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
3'-UTR
Gene Model of Parasite PBANKA_0719300
Gene productbifunctional dihydrofolate reductase-thymidylate synthase, putative
Gene product: Alternative namedhfr/ts
Primer information details of the primers used for amplification the 3'-UTR sequences  Click to view information
Primer information details of the primers used for amplification the 3'-UTR sequences  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
Insertion/Replacement locus
Replacement / InsertionReplacement locus
Gene Model of Parasite PBANKA_0306000
Gene product6-cysteine protein
Gene product: Alternative name230p
Primer information details of the primers used for amplification of the target sequences  Click to view information
Primer information details of the primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
Sequence Primer 3
Additional information primer 3
Sequence Primer 4
Additional information primer 4