Mutant/mutation
The mutant lacks expression of FABI

Protein (function)
FABI is an enzyme of the bacterial like type II fatty acid biosynthesis (FAS-II) pathway. In Plasmodium FAS-II enzymes have been localized to the apicoplast, a nonphotosynthetic plastid organelle of cyanobacterial origin.
FAS-II requires acetyl-Coenzyme A (CoA), which can be converted from pyruvate by the pyruvate dehydrogenase complex. Acetyl-CoA carboxylase converts acetyl-CoA to malonyl-CoA, which is tethered to an acyl carrier protein (ACP) by malonyl-CoA:ACP transacylase (FabD). This produces malonyl-ACP, which, in conjunction with acetyl-CoA, is acted upon by β-ketoacyl-ACP synthase III (Fab H) to form β-ketoacyl-ACP. This precursor enters the FAS-II elongation cycle, mediated by FabB/F (β-ketoacyl-acyl-carrier-protein (ACP) synthase), FabG (β-ketoacyl-ACP reductase), FabZ/A (β-hydroxyacyl-ACP dehydratase), and FabI (trans-2-enoyl-ACP reductase). These four FAS-II enzymes iteratively catalyze the addition of two carbon chains to a growing fatty acyl carbon chain via condensation, reduction, dehydration, and reduction steps, respectively.

Phenotype
The phenotype analyses show that FABI is not essential for blood stage development, mosquito stage development and initial infection of the liver. The results indicate a key role of FABI in the formation of infective liver stage merozoites demonstrating the importance of FASII pathway for synthesis of fatty acids during late liver stage development. See also Additional Information below.

Additional information
Drug-susceptibility assays showed that blood stages of mutant and wild type parasites had the same sensitivity to triclosan, indicating that FABI is not the target of triclosan.

Mutant blood stages produced fatty acids, indicating that FABI is not required for fatty acid synthesis in the blood stage parasites.

Injection of 1000 Pb∆fabI SPZs produced a blood-stage infection in only 5/16 mice, with the infected mice showing a delay in patency of 4 days. Increasing the Pb∆fabI inoculum to 10,000 SPZs resulted in patent infections in 13/15 mice, with those mice again showing an average delay of 4 days compared to controls. The data demonstrate that P. berghei parasites lacking FabI produce SPZs that are highly attenuated in their infectivity to the mammalian host.

A second control mutant, PbfabI^Rec, was generated in which the endogenous fabI coding region was replaced with the full length fabI gene along with the tgdhfr-ts selectable marker. The 1.3 kb full-length fabI gene was amplified using primers Mp13 and Mp14 (CCAGATCTATTGTTAATAGAATTTTTATTGAATATATTC and CCGCGCGCGAATAGAGTGAGAAAGAGAATGAAAGG respectively.

Other mutants
RMgm-180: A mutant expressing myc tagged FABI
RMgm-181: A mutant expressing myc tagged FABZ
RMgm-182: A mutant expressing myc tagged FABG
RMgm-184: A mutant lacking expression of FABZ
RMgm-183: A mutant lacking expression of FABB/F