SummaryRMgm-5571
|
||||||||
*RMgm-5571| Successful modification | The parasite was generated by the genetic modification |
| The mutant contains the following genetic modification(s) | Gene mutation |
| Reference (PubMed-PMID number) |
Reference 1 (PMID number) : 38802937 |
| MR4 number | |
| top of page | |
| Parent parasite used to introduce the genetic modification | |
| Rodent Malaria Parasite | P. yoelii |
| Parent strain/line | P. y. yoelii 17XNL |
| Name parent line/clone | Not applicable |
| Other information parent line | |
| top of page | |
| The mutant parasite was generated by | |
| Name PI/Researcher | Lin L, Li J |
| Name Group/Department | State Key Laboratory of Cellular Stress Biology, School of Life Sciences, Faculty of Medicine and Li |
| Name Institute | Xiamen University |
| City | Xiamen |
| Country | China |
| top of page | |
| Name of the mutant parasite | |
| RMgm number | RMgm-5571 |
| Principal name | pytctp(−IN+HA) |
| Alternative name | |
| Standardized name | |
| Is the mutant parasite cloned after genetic modification | No |
| top of page | |
| Phenotype | |
| Asexual blood stage | The absence of the 5’UTR intron did not significantly affect parasite growth in mice or host mortality. |
| Gametocyte/Gamete | The gametocyte rates of the parasite clones with the 3xHA-tag (pytctp(+IN+HA); RMgm-5572), pytctp−IN+HA and pytctp+IN+HAc) were significantly lower than WT 17XL or the untagged clones without the intron (pytctp(−IN)), indicating that the introduction of 3xHA-tag in pytctp influenced the gametocyte production. No oocyst/sporozoites the parasites bearing 3xHA-tag in pytctp |
| Fertilization and ookinete | Not tested |
| Oocyst | The gametocyte rates of the parasite clones with the 3xHA-tag (pytctp(+IN+HA); RMgm-5572), pytctp−IN+HA and pytctp+IN+HAc) were significantly lower than WT 17XL or the untagged clones without the intron (pytctp(−IN)), indicating that the introduction of 3xHA-tag in pytctp influenced the gametocyte production. No oocyst/sporozoites the parasites bearing 3xHA-tag in pytctp |
| Sporozoite | The gametocyte rates of the parasite clones with the 3xHA-tag (pytctp(+IN+HA); RMgm-5572), pytctp−IN+HA and pytctp+IN+HAc) were significantly lower than WT 17XL or the untagged clones without the intron (pytctp(−IN)), indicating that the introduction of 3xHA-tag in pytctp influenced the gametocyte production. No oocyst/sporozoites the parasites bearing 3xHA-tag in pytctp |
| Liver stage | Not tested |
| Additional remarks phenotype | Mutant/mutation See also mutant RMgm-5570 for a P. yoelii mutant paraste lacking expression of TCTP From the Abstract: |
Mutated: Mutant parasite with a mutated gene| top of page | |||||||||||||||||||||||||||
| Details of the target gene | |||||||||||||||||||||||||||
| Gene Model of Rodent Parasite | PY17X_1111700 | ||||||||||||||||||||||||||
| Gene Model P. falciparum ortholog | PF3D7_0511000 | ||||||||||||||||||||||||||
| Gene product | translationally-controlled tumor protein homolog | ||||||||||||||||||||||||||
| Gene product: Alternative name | TCTP | ||||||||||||||||||||||||||
| top of page | |||||||||||||||||||||||||||
| Details of the genetic modification | |||||||||||||||||||||||||||
| Short description of the mutation | TCTP lacking the 5'UTR intron and a C-terminal 3xHA tag. | ||||||||||||||||||||||||||
| Inducable system used | No | ||||||||||||||||||||||||||
| Short description of the conditional mutagenesis | Not available | ||||||||||||||||||||||||||
| Additional remarks inducable system | |||||||||||||||||||||||||||
| Type of plasmid/construct | CRISPR/Cas9 construct: integration through double strand break repair | ||||||||||||||||||||||||||
| PlasmoGEM (Sanger) construct/vector used | No | ||||||||||||||||||||||||||
| Modified PlasmoGEM construct/vector used | No | ||||||||||||||||||||||||||
| Plasmid/construct map | |||||||||||||||||||||||||||
| Plasmid/construct sequence | |||||||||||||||||||||||||||
| Restriction sites to linearize plasmid | |||||||||||||||||||||||||||
| Selectable marker used to select the mutant parasite | hdhfr/yfcu | ||||||||||||||||||||||||||
| Promoter of the selectable marker | eef1a | ||||||||||||||||||||||||||
| Selection (positive) procedure | pyrimethamine | ||||||||||||||||||||||||||
| Selection (negative) procedure | No | ||||||||||||||||||||||||||
| Additional remarks genetic modification | The methods of gene tagging and gene disruption using the CRISPR/Cas9 system were basically as described previously (Zhang C, Xiao B, Jiang Y, Zhao Y, Li Z, Gao H, et al. Efficient editing of malaria parasite genome using the CRISPR/Cas9 system. mBio. 2014;5:e01414‑14.). CRISPR/Cas9 was usexd to tag the pytctp with 3xHA at the 5′ end of the gene and at the same time generated parasites with or without the 5′UTR intron. Using the P. yoelii 17XL parasite carrying the 5’UTR intron, we designed a guide RNA (GTCTTTATATACTTTCATTTTGG ) at the 5′ region to insert the 3xHA tag to generate 5′ HA-tagged pytctp gene with or without the 5′UTR intron. To construct the plasmids for tagging PyTCTP with 3 × HA at the N-terminal of the protein and simultaneously generated parasites with or with out the 5′UTR intron, we first amplified a ~ 600-bp segment from the 5’UTR region with or without intron as left homologous arm and a 200–400-bp fragment from N-terminal coding region as right homologous arm. A DNA sequence encoding the 3×HA (YPYDVPDYAGAYPYDVPDYAGAYPYDVPDYA) was inserted between the left and right arms in the frame and cloned into the pYC5 vector using restriction enzymes Nco I and Sac II. To construct the plasmid to delete the coding region of the pytctp gene, we used primer pairs K55/K53 and K35/K33 to amplify 5’UTR and 3’UTR regions (~ 500 bp) as left and right homologous arms and cloned them into restriction sites of Kpn I/Nco I and Xho I/Eco RI of the pYC5 vector. Oligonucleotide sequences for sgRNAs designed to target specific sites in the 17XL genome were ligated into the plasmid using enzyme Bsm BI. All oligonucleotides were commercially synthesized by Xiamen Borui Biological Technology Co., Ltd. Transfection, drug selection of transformed parasites and limiting-dilution cloning were performed as described. | ||||||||||||||||||||||||||
| Additional remarks selection procedure | |||||||||||||||||||||||||||
| |||||||||||||||||||||||||||
| top of page | |||||||||||||||||||||||||||