RMgmDB - Rodent Malaria genetically modified Parasites

Summary

RMgm-357
Malaria parasiteP. berghei
Genotype
MutatedGene model (rodent): PBANKA_1008200; Gene model (P.falciparum): PF3D7_1436600; Gene product: cGMP-dependent protein kinase (PKG)
Details mutation: The mutant contains a mutated pkg gene with two FRT sites
Details conditional mutagenesis: The FRTed sequenmce of pkg is removed in the sporozoite stage by the Flp/FRT system
Transgene
 Transgene not Plasmodium: FlpL recombinase of yeast (FlpL)
Promoter: Gene model: PBANKA_1349800; Gene model (P.falciparum): PF3D7_1335900; Gene product: thrombospondin-related anonymous protein | sporozoite surface protein 2 (TRAP; SSP2; SSP-2)
3'UTR: Gene model: PBANKA_1349800; Gene product: sporozoite surface protein 2 thrombospondin-related anonymous protein (sporozoite surface protein 2; SSP2; SSP-2)
Insertion locus: Gene model: PBANKA_1349800; Gene product: sporozoite surface protein 2 thrombospondin-related anonymous protein (sporozoite surface protein 2; SSP2; SSP-2)
Phenotype Sporozoite; Liver stage;
Last modified: 26 December 2011, 18:16
  *RMgm-357
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene mutation, Introduction of a transgene
Reference (PubMed-PMID number) Reference 1 (PMID number) : 19940133
MR4 number
top of page
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei NK65
Name parent line/clone P. berghei NK65 TRAP/FlpL(-)
Other information parent lineTRAP/FlpL(-)(RMgm-268) is a P. berghei NK65 mutant that expresses the yeast Flpl recombinase under the control of the trap promoter. The mutant does not contain a drug-selectable marker (PubMed: PMID: 19380117).
top of page
The mutant parasite was generated by
Name PI/ResearcherA. Falae; R. Menard; P. Bhanot
Name Group/DepartmentDepartment of Microbiology and Molecular Genetics
Name InstituteUMDNJ – New Jersey Medical School
CityNewark
CountryNew Jersey, USA
top of page
Name of the mutant parasite
RMgm numberRMgm-357
Principal namePbPKG-
Alternative namecKO
Standardized name
Is the mutant parasite cloned after genetic modificationYes
top of page
Phenotype
Asexual blood stageNot different from wild type
Gametocyte/GameteNot different from wild type
Fertilization and ookineteNot different from wild type
OocystNot different from wild type
SporozoiteSporozoites are not infectious to mice. Intravenous injection of mice with mutant sporozoites did not lead to a blood stage infection. Sporozoites developed however into late liver-stages (liver schizonts).
Liver stageSporozoites are not infectious to mice. Intravenous injection of mice with mutant sporozoites did not lead to a blood stage infection. Sporozoites developed however into late liver-stages (liver schizonts). In cultured HepG2 cells mature liver stages are formed but strongly reduced numbers of merosomes are released into the culture medium compared to wild type parasites.
Additional remarks phenotype

Mutant/mutation
The mutant is a 'Flp/FRT conditional knock-out mutant' of PKG (cGMP-dependent protein kinase). The mutant expresses the yeast Flp recombinase under the control of the trap promoter  and contains a mutated pkg gene that contains two FRT sites. These  FRT sites are located in the intron separating exon 3 and exon 4, and downstream of the 3’ expression sequence of pkg. This mutant has been generated by replacement of the endogenous pkg gene by an 'FRTed' pkg gene in mutant RMgm-268 that expresses Flp.

The pkg locus locus is disrupted by using the Flp/FRT site-specific recombination (SSR) system (see RMgm-268). Removal of the FRTed pkg sequence has been achieved by  transmission of the mutant through mosquitoes, thereby activating expression of the Flp recombinase in sporozoites that resulted in the excision of the  pkg sequence which was flanked by FRT sequences.

Protein (function)
Cyclic GMP-dependent protein kinases (PKGs) are the major mediators of the cGMP signal transduction pathway and regulate a variety of physiological effects. PKG is is a serinethreonine kinase that transfers the γ-phosphate of ATP, in a cGMP-dependent manner, to a variety of substrate proteins.

Phenotype
Unsuccessful attempts to disrupt the pkg gene using standard methods of gene disruption (see RMgm-325; RMgm-544) indicate an essential role of PKG during blood stage development.

In the mutant described here the Flp/FRT site-specific recombination (SSR) system of yeast has been used to silence PKG expression specifically in liver stages. Removal of the FRTed pkg sequence has been achieved by  transmission of the mutant through mosquitoes, thereby activating expression of the Flp recombinase in sporozoites that resulted in the excision of the  pkg sequence which was flanked by FRT sequences.

The phenotype analyses indicate the PKG plays an essential role during liver stage development. Mutant sporozoites are able to invade hepatocytes and undergo intracellular development. However, they remain blocked as late liver-stages that do not release merosomes into the medium.

Additional information
In wild type parasites pkg-transcripts were detected in early and late liver stages developing in tissue-culture cells.

Other mutants
RMgm-325: Unsuccessful attempts to disrupt the pkg gene
RMgm-544: Unsuccessful attempts to disrupt the pkg gene
RMgm-311: A mutant expressing a GFP-tagged (C-terminal) form of PKG

  Mutated: Mutant parasite with a mutated gene
top of page
Details of the target gene
Gene Model of Rodent Parasite PBANKA_1008200
Gene Model P. falciparum ortholog PF3D7_1436600
Gene productcGMP-dependent protein kinase
Gene product: Alternative namePKG
top of page
Details of the genetic modification
Short description of the mutationThe mutant contains a mutated pkg gene with two FRT sites
Inducable system usedFlp/FRT
Short description of the conditional mutagenesisThe FRTed sequenmce of pkg is removed in the sporozoite stage by the Flp/FRT system
Additional remarks inducable system
Click to view information
Click to hide information
A recently developed P. berghei conditional mutagenesis approach was utilized that uses stage-specific expression of a temperature-sensitive variant of the yeast recombinase, flippase (FlpL) to catalyze the excision of DNA placed between two Flp Recognition Target sequences (FRT) (see RMgm-268). FlpL catalyzes site-specific DNA recombination at a temperature range of 25°-30°C. The pkg open reading frame (ORF) consists of five exons, with exons 4 and 5 encoding four cGMP binding sites and a kinase domain. The locus was modified by inserting two FRT sites carried on a double crossover targeting plasmid. Homologous integration of the plasmid would place one FRT site in the intron separating exon 3 and exon 4, and a second FRT site downstream of the 3’ expression sequence of the gene. The plasmid was transfected into parasites that express FlpL under the control of the sporozoite-specific promoter of the Thrombospondin Related Anonymous Protein gene (TRAP/FlpL) (see RMgm-268), causing the excision of the FRT-flanked sequence specifically in sporozoites. Recombinant parasites were readily selected, showing that the 5’ FRT site located between exons 3 and 4 does not impair normal expression of PKG.
Type of plasmid/constructPlasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid EcoRI
Selectable marker used to select the mutant parasitehdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modificationThe pkg open reading frame (ORF) consists of five exons, with exons 4 and 5 encoding four cGMP binding sites and a kinase domain. The locus was modified by inserting two FRT sites carried on a double crossover targeting plasmid. Homologous integration of the plasmid would place one FRT site in the intron separating exon 3 and exon 4, and a second FRT site downstream of the 3’ expression sequence of the gene. The plasmid was transfected into parasites that express FlpL under the control of the sporozoite-specific promoter of the Thrombospondin Related Anonymous Protein gene (TRAP/FlpL) (see RMgm-268), causing the excision of the FRT-flanked sequence specifically in sporozoites. Recombinant parasites were readily selected, showing that the 5’ FRT site located between exons 3 and 4 does not impair normal expression of PKG.
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1GCGGCCGCCACCAAGAGAGTAAACAC
Additional information primer 12.0kB fragment encompassing the 5’ UTR region and exons 1-3 of PbPKG (NotI)
Sequence Primer 2GCGGCCGCCGAGCCCCAAAACATTAT
Additional information primer 22.0kB fragment encompassing the 5’ UTR region and exons 1-3 of PbPKG (NotI)
Sequence Primer 3CTCGAGAAAAAGGCACACATGTTTGC
Additional information primer 33.0 kB fragment encompassing exons 4-5 and the 3’UTR region of PbPKG (XhoI)
Sequence Primer 4CTCGAGAAGTAAAGAATAGCGAAAT
Additional information primer 43.0 kB fragment encompassing exons 4-5 and the 3’UTR region of PbPKG (XhoI)
Sequence Primer 5GGTACCACAAATATTGTTTTTTCTTTTA
Additional information primer 50.5 kB fragment (KpnI)
Sequence Primer 6GAATTCGATATGTATGTCGGGGATTA
Additional information primer 60.5 kB fragment (EcoRI)
top of page
  Transgene: Mutant parasite expressing a transgene
top of page
Type and details of transgene
Is the transgene Plasmodium derived Transgene: not Plasmodium
Transgene nameFlpL recombinase of yeast (FlpL)
top of page
Details of the genetic modification
Inducable system usedFlp/FRT
Additional remarks inducable system The mutant expresses the yeast FlpL recombinase under the control of the promoter of trap. The mutant does not contain a selectable marker. This marker (the hdhfr gene) has been removed from the genome by using the Flp/FRT site-specific recombination (SSR) system. Removal of the hdhfr gene has been achieved by transmission of the mutant through mosquitoes, thereby activating expression of the FlpL recombinase that resulted in the excision of the hdhfr gene that was flanked by FRT sequences.
Type of plasmid/constructPlasmid single cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid
Selectable marker used to select the mutant parasitehdhfr
Promoter of the selectable markereef1a
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modificationThe FlpL coding sequence was flanked by 1.5 kb and 0.6 kb of 5′ and 3′ regulatory sequences of trap, respectively, and associated with a FRTed hdhfr selectable marker containing its own (eef1a) promoter and terminator sequences.
The plasmid was linearized in the 5′ TRAP regulatory sequence to direct gap repair and plasmid integration by single crossover recombination at the homologous chromosomal locus, leaving the endogenous trap gene intact. The plasmid contained the hdhfr selectable marker that is flanked with the 34bp FRT sequences
Additional remarks selection procedure
top of page
Other details transgene
top of page
Promoter
Gene Model of Parasite PBANKA_1349800
Gene Model P. falciparum ortholog PF3D7_1335900
Gene productthrombospondin-related anonymous protein | sporozoite surface protein 2
Gene product: Alternative nameTRAP; SSP2; SSP-2
Primer information details of the primers used for amplification of the promoter sequence  Click to view information
Primer information details of the primers used for amplification of the promoter sequence  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
top of page
3'-UTR
Gene Model of Parasite PBANKA_1349800
Gene productsporozoite surface protein 2 thrombospondin-related anonymous protein
Gene product: Alternative namesporozoite surface protein 2; SSP2; SSP-2
Primer information details of the primers used for amplification the 3'-UTR sequences  Click to view information
Primer information details of the primers used for amplification the 3'-UTR sequences  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
Insertion/Replacement locus
Replacement / InsertionInsertion locus
Gene Model of Parasite PBANKA_1349800
Gene productsporozoite surface protein 2 thrombospondin-related anonymous protein
Gene product: Alternative namesporozoite surface protein 2; SSP2; SSP-2
Primer information details of the primers used for amplification of the target sequences  Click to view information
Primer information details of the primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
Sequence Primer 3
Additional information primer 3
Sequence Primer 4
Additional information primer 4
top of page
P.berghei model of malaria
Technical design and realization: S. Mededovic and A. van Wigcheren