Summary

RMgm-325
Malaria parasiteP. berghei
Genotype
Genetic modification not successful
DisruptedGene model (rodent): PBANKA_1008200; Gene model (P.falciparum): PF3D7_1436600; Gene product: cGMP-dependent protein kinase (PKG)
PhenotypeNo phenotype has been described
Last modified: 21 December 2011, 15:53
  *RMgm-325
Successful modificationThe gene/parasite could not be changed/generated by the genetic modification.
The following genetic modifications were attempted Gene disruption
Number of attempts to introduce the genetic modification Unknown
Reference (PubMed-PMID number) Reference 1 (PMID number) : 19779564
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone P. berghei ANKA 2.34
Other information parent lineP. berghei ANKA 2.34 is a cloned, gametocyte producer line of the ANKA strain (PubMed: PMID: 15137943).
Attempts to generate the mutant parasite were performed by
Name PI/ResearcherR.W. Moon; D.A. Baker; O. Billker
Name Group/DepartmentDepartment of Cell and Molecular Biology
Name InstituteImperial College London
CityLondon
CountryUK

  Disrupted: Mutant parasite with a disrupted gene
Details of the target gene
Gene Model of Rodent Parasite PBANKA_1008200
Gene Model P. falciparum ortholog PF3D7_1436600
Gene productcGMP-dependent protein kinase
Gene product: Alternative namePKG
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct usedUnknown
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid
Partial or complete disruption of the geneComplete
Additional remarks partial/complete disruption
Selectable marker used to select the mutant parasiteUnknown
Promoter of the selectable markerUnknown
Selection (positive) procedureUnknown
Selection (negative) procedureNo
Additional remarks genetic modificationIn the paper it is reported that repeated attempts were made to disrupt the gene. No information/details is provided on the number of attempts to disrupt the gene and the construct used to disrupt the gene.

(Gene models for PKG PB000726.02.0; PB300651.00.0)

See RMgm-311 for a mutant expressing a GFP-tagged (C-terminal) form of PKG (cGMP-dependent protein kinase).

See RMgm-357 for a ‘conditional knock-out mutant’ lacking expression of PKG in liver stages. The Flp/FRT site-specific recombination (SSR) system of yeast has been used to silence PKG expression specifically in liver stages

Cyclic GMP-dependent protein kinases (PKGs) are the major mediators of the cGMP signal transduction pathway and regulate a variety of physiological effects.

In the paper it is shown that a selective inhibitor of apicomplexan PKG, the ATP analog Compound 1, potently blocked ookinete motility.

In the paper evidence is presented that in ookinetes GCß is the main source for cGMP and that a cyclic GMP signaling module exists that regulates gliding motility of ookinetes. This evidence is partly based on the analysis of mutants lacking expression PDEδ (RMgm-308) and GCβ (RMgm-307) and a mutant lacking expression of both GCβ and PDEδ (RMgm-309). These analyses indicate that PDEδ is the relevant cGMP degrading enzyme. Signalling via a cGMP-dependent protein kinase (PKG; PF14_0346; PB000726.02.0) may regulate ookinete differentiation and motility.

RMgm-544: Unsuccessful attempts to disrupt the pkg gene

RMgm-311: A mutant expressing a GFP-tagged (C-terminal) form of PKG

Disruption of the P. falciparum ortholog has been attempted (Solyakov et al., 2011, Nat Commun, 2:565).
The gene is likely essential for asexual proliferation as integration of the KO vector was not achieved. Accesibility of the locus to recombination was verified by C-terminal tagging.
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1TCGTGCGCATGTATATGTCTGGATG
Additional information primer 15’ region of homology Fwd
Sequence Primer 2ACCCACTCCCAAAAATATGCGC
Additional information primer 25’ region of homology Rev
Sequence Primer 3CCCCAAGGAAGAATCGGTTGC
Additional information primer 33’ region of homology Fwd
Sequence Primer 4CGAGAAAAAAGGTGAGAAAGGGAAACATG
Additional information primer 43’ region of homology Rev
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6