RMgmDB - Rodent Malaria genetically modified Parasites

Summary

RMgm-306

Malaria parasite	P. yoelii
Genotype
Tagged	Gene model (rodent): PY17X_1310300; Gene model (P.falciparum): PF3D7_1442600; Gene product: TRAP-like protein \| sporozoite-specific transmembrane protein S6 (TREP; TRAP-related protein, S6; sporozoite specific gene 6; UOS3) Name tag: c-myc
Phenotype	Oocyst; Sporozoite;

Last modified: 21 February 2010, 10:31

*RMgm-306

Successful modification	The parasite was generated by the genetic modification
The mutant contains the following genetic modification(s)	Gene tagging
Reference (PubMed-PMID number)	Reference 1 (PMID number) : 18710954
MR4 number
top of page
Parent parasite used to introduce the genetic modification
Rodent Malaria Parasite	P. yoelii
Parent strain/line	P. y. yoelii 17XNL
Name parent line/clone	Not applicable
Other information parent line	17XNL is a non-lethal strain of P. yoelii
top of page
The mutant parasite was generated by
Name PI/Researcher	S.A. Mikolajczak; S.H.I. Kappe
Name Group/Department	Not applicable
Name Institute	Seattle Biomedical Research Institute
City	Seattle
Country	USA
top of page
Name of the mutant parasite
RMgm number	RMgm-306
Principal name	uos3-myc
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modification	Yes
top of page
Phenotype
Asexual blood stage	Not different from wild type
Gametocyte/Gamete	Not different from wild type
Fertilization and ookinete	Not different from wild type
Oocyst	Anti-Myc antibody staining of UOS3-myc oocysts at day 10 postinfection revealed that UOS3 localized to the apical end of oocyst sporozoites that bud from the oocysts.
Sporozoite	Anti-Myc antibody staining of UOS3-myc oocysts at day 10 postinfection revealed that UOS3 localized to the apical end of oocyst sporozoites that bud from the oocysts. A similar localization of UOS3 was observed in UOS3-myc hemolymph sporozoites.
Liver stage	Not tested
Additional remarks phenotype	Mutant/mutation The mutant expresses c-myc-tagged version (C-terminal) of UOS3 (upregulated in oocyst sporozoites 3; TREP, TRAP-related protein; S6, sporozoite specific gene 6 ) Protein (function) UOS3 is a transmembrane protein that possesses a short cytoplasmic tail typical of members of the TRAP/MIC2 family of proteins as well as a single thrombospondin type I repeat (TSR, TSP) domain. UOS3 was detected in a genome-wide expression screen with the rodent malaria model P. yoelii. It was found that at transcription of at least 47 genes is specifically upregulated before salivary gland infection (UOS genes: upregulated in oocyst sporozoites) but downregulated after salivary gland infection. UOS3 exhibited significant differential expression in sporozoites. UOS3 transcription is high in oocyst-derived sporozoites but low in salivary gland sporozoites. Phenotype analyses of mutants lacking expression of UOS3/TREP/S6 (RMgm-145, RMgm-159, RMgm-305) indicate a role of this protein in invasion of salivary glands. UOS3/TREP/S6 is not essential for infectivity to the mammalian host. Phenotype Phenotype analyses indicate that UOS3 is expressed in oocyst-derived sporozoites. UOS3 was found to be located at the apical end of sporozoites. Simultaneous staining of UOS3myc and TRAP, a known micronemal protein, showed only a partial overlap in localization. The localization and the punctuate appearance of UOS3myc distribution suggests that the protein is a part of the apical invasive/secretory organelles. Additional information Other mutants RMgm-145: A mutant lacking expression of TREP/S6/UOS3 (P. berghei) RMgm-159: A mutant lacking expression of TREP/S6/UOS3 (P. berghei) RMgm-305: A mutant lacking expression of TREP/S6/UOS3 (P. Yoelii)

Tagged: Mutant parasite with a tagged gene

top of page

Details of the target gene

Gene Model of Rodent Parasite

PY17X_1310300

Gene Model P. falciparum ortholog

PF3D7_1442600

Gene product

TRAP-like protein | sporozoite-specific transmembrane protein S6

Gene product: Alternative name

TREP; TRAP-related protein, S6; sporozoite specific gene 6; UOS3

top of page

Details of the genetic modification

Name of the tag

c-myc

Details of tagging

C-terminal

Additional remarks: tagging

Quadruple Myc tag sequence (4x myc). For fluorescent detection, the secondary antibodies Alexa Fluor 488 and Alexa Fluor 594 were used

Commercial source of tag-antibodies

Antibody A-14 (Santa Cruz Biotechnology). Secondary antibodies Alexa Fluor 488 and Alexa Fluor 594 (

Type of plasmid/construct

Plasmid single cross-over

PlasmoGEM (Sanger) construct/vector used

Modified PlasmoGEM construct/vector used

Plasmid/construct map

Plasmid/construct sequence

Restriction sites to linearize plasmid

BsaBI

Selectable marker used to select the mutant parasite

tgdhfr

Promoter of the selectable marker

pbdhfr

Selection (positive) procedure

pyrimethamine

Selection (negative) procedure

Additional remarks genetic modification

For the generation of UOS3 tagged with the Myc epitope (UOS3-myc), a quadruple (4×) Myc tag sequence was introduced into the b3D.DT∧H.∧D vector (catalog no. MRA-80 in the MR4-Malaria Research and Reference Reagent Resource Center; http://www.malaria.mr4.org) followed by the 3′ untranslated region of the P. berghei dihydrofolate reductase gene. The C-terminal fragment of uos3 (without the stop codon) was cloned into the plasmid in frame and adjacent to the Myc tag. Insertion resulted in expression of a UOS3myc chimeric protein under the control of the endogenous UOS3 5′ upstream DNA region

Additional remarks selection procedure

Primer information: Primers used for amplification of the target sequences Click to view information

Primer information: Primers used for amplification of the target sequences Click to hide information

Sequence Primer 1	GCCCGCGGTACACATGCAAAATAAAGCGGATA
Additional information primer 1	C-terminal fragment of uos3 (SacII)
Sequence Primer 2	GGACTAGTTGACCAATCATCATTAACGTAACT
Additional information primer 2	C-terminal fragment of uos3 (SpeI)
Sequence Primer 3
Additional information primer 3
Sequence Primer 4
Additional information primer 4
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6

top of page