RMgmDB - Rodent Malaria genetically modified Parasites

Summary

RMgm-305
Malaria parasiteP. yoelii
Genotype
DisruptedGene model (rodent): PY17X_1310300; Gene model (P.falciparum): PF3D7_1442600; Gene product: TRAP-like protein | sporozoite-specific transmembrane protein S6 (TREP; TRAP-related protein, S6; sporozoite specific gene 6; UOS3)
Transgene
 Transgene not Plasmodium: RFP
Promoter: Gene model: PBANKA_1133300; Gene model (P.falciparum): PF3D7_1357100; Gene product: elongation factor 1-alpha (eef1a)
3'UTR: Gene model: PBANKA_0719300; Gene product: bifunctional dihydrofolate reductase-thymidylate synthase, putative (dhfr/ts)
Replacement locus: Gene model: PY04986; Gene product: TRAP-related protein (UOS3, up-regulated in ookinete sporozoites gene 3)
Phenotype Sporozoite; Liver stage;
Last modified: 21 February 2010, 10:30
  *RMgm-305
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene disruption, Introduction of a transgene
Reference (PubMed-PMID number) Reference 1 (PMID number) : 18710954
MR4 number
top of page
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. yoelii
Parent strain/lineP. y. yoelii 17XNL
Name parent line/clone Not applicable
Other information parent line17XNL is a non-lethal strain of P. yoelii
top of page
The mutant parasite was generated by
Name PI/ResearcherS.A. Mikolajczak; S.H.I. Kappe
Name Group/DepartmentNot applicable
Name InstituteSeattle Biomedical Research Institute
CitySeattle
CountryUSA
top of page
Name of the mutant parasite
RMgm numberRMgm-305
Principal nameuos3- (rfp)
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
top of page
Phenotype
Asexual blood stageNot different from wild type
Gametocyte/GameteNot different from wild type
Fertilization and ookineteNot different from wild type
OocystNot different from wild type
SporozoiteNormal numbers of midgut sporozoites are formed. Strong reduction in numbers of salivary gland sporozoites. Salivary gland sporozoite numbers for the mutant at day 14 after the infected meal were dramatically reduced (90% reduction) compared to wild type sporozoite numbers. Fluorescence microscopy observation of mutant-infected salivary glands suggested that the sporozoites were mainly attached to the glands but did not localize to the interior of the gland. Infection of mice by bite of infected mosquitoes did not result in blood stage infections.
Injection of 10(5) oocyst-derived or 2 x 10(4) hemolymph-derived mutant sporozoites intravenously into mice, resulted blood-stage parasitemia in all mice on the same day (day 4) as the wild type-sporozoite control-injected mice.
Liver stageInfection of mice by bite of infected mosquitoes did not result in blood stage infections.
Injection of 10(5) oocyst-derived or 2 x 10(4) hemolymph-derived mutant sporozoites intravenously into mice, resulted blood-stage parasitemia in all mice on the same day (day 4) as the wild type-sporozoite control-injected mice.
Additional remarks phenotype

Mutant/mutation
The mutant lack expression of UOS3 (upregulated in oocyst sporozoites 3; TREP, TRAP-related protein; S6, sporozoite specific gene 6 ) and expresses RFP under the control of the constitutive eef1a promoter. The uos3 gene has been disrupted by gene replacement by double homologous recombination. A fluorescent protein (RFP) cassette is introduced into the disruption vector in which RFP is under the control of the constitutive eef1a promoter. The introduction of the fluorescent marker via the replacement strategy confers the stable integration of the RFP marker.

Protein (function)
UOS3 is a transmembrane protein that possesses a short cytoplasmic tail typical of members of the TRAP/MIC2 family of proteins as well as a single  thrombospondin type I repeat (TSR, TSP) domain. UOS3 was detected in a genome-wide expression screen with the rodent malaria model P. yoelii. It was found hat transcription of at least 47 genes is specifically upregulated before salivary gland infection (UOS genes: upregulated in oocyst sporozoites) but downregulated after salivary gland infection. UOS3 exhibited significant differential expression in sporozoites. UOS3 transcription is high in oocyst-derived sporozoites but low in salivary gland sporozoites.

Phenotype
The phenotype analyses indicate a role of UOS3 in invasion of salivary glands. The results of infection of mice by injection of oocyst-derived sporozoites indicate that UOS3 is not essential for infectivity to the mammalian host.

Additional information
UOS3 was found to be located at the apical end of sporozoites, in the secretory organelles (see mutant RMgm-306 which expressses a c-myc tagged version of UOS3).
Other mutants lacking expression of UOS3 has been generated and analysed (see RMgm-145; RMgm-159). In these studies the protein is named TREP or S6. These mutants show a comparable phenotype.

Other mutants
RMgm-145: A mutant lacking expression of TREP/S6/UOS3 (P. berghei)
RMgm-159: A mutant lacking expression of TREP/S6/UOS3 (P. berghei)
RMgm-306: A mutant expressing a c-myc tagged version of TREP/S6/UOS3 (P. yoelii)

  Disrupted: Mutant parasite with a disrupted gene
top of page
Details of the target gene
Gene Model of Rodent Parasite PY17X_1310300
Gene Model P. falciparum ortholog PF3D7_1442600
Gene productTRAP-like protein | sporozoite-specific transmembrane protein S6
Gene product: Alternative nameTREP; TRAP-related protein, S6; sporozoite specific gene 6; UOS3
top of page
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct usedPlasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid SbfI
Partial or complete disruption of the genePartial
Additional remarks partial/complete disruption The gene was disrupted by deleting the N terminus of UOS3 with a plasmid carrying the Toxoplasma gondii dihydrofolate reductase (TgDHFR) and an RFP cassette by homologous recombination. Close evaluation of the N-terminal domain of UOS3 revealed a partially conserved thrombospondin repeat (TSR) domain
Selectable marker used to select the mutant parasitetgdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modificationA two step PCR technique was adapted for the efficient generation of the targeting construct. See figure 1: Mikolajczak et.al., Mol Biochem Parasitol 158 (2007) 213-216. In this paper a cloning procedure is described for gene replacement by double homologous recombination in P. yoelii, which requires only one digestion and ligation step. This significantly shortens the time required to complete the production of the targeting vector. Furthermore, for more efficient phenotypic evaluation of the mutant parasites, a fluorescent protein (RFP) cassette is introduced into the targeting vector in which RFP is under the control of the constitutive eef1a promoter. This allows for a more rapid assessment of parasite growth in all of its developmental stages. In addition, the introduction of the fluorescent marker via the replacement strategy confers the stable integration of the marker.
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1GGGATATCGCAATGTTAAACAAGCAATATGCTC
Additional information primer 1Pr.1 (EcoRV); 3'UTR TSR domain forward + amplification of the final PCR product
Sequence Primer 2TTGCCCTCCTGCAGGTTCGTGGTCTACACTTGTAT
Additional information primer 2Pr.2 (SbfI); 3'UTR TSR domain reverse + annealing of 5'UTR and 3'UTR
Sequence Primer 3GTGGTTTACCTGCAGGAGGGCAATTTGTATCATATGACC
Additional information primer 3Pr.3 (SbfI); 5'UTR TSR domain forward + annealing of 5'UTR and 3'UTR
Sequence Primer 4ATGCGGCCGCGCTGTATAGTTTTTTGAAAGTGGAG
Additional information primer 4Pr.4 (NotI); 5'UTR TSR domain reverse + amplification of the final PCR product
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6
top of page
  Transgene: Mutant parasite expressing a transgene
top of page
Type and details of transgene
Is the transgene Plasmodium derived Transgene: not Plasmodium
Transgene nameRFP
top of page
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/constructPlasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid SbfI
Selectable marker used to select the mutant parasitetgdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modificationA two step PCR technique was adapted for the efficient generation of the targeting construct. See figure 1: Mikolajczak et.al., Mol Biochem Parasitol 158 (2007) 213-216. In this paper a cloning procedure is described for gene replacement by double homologous recombination in P. yoelii, which requires only one digestion and ligation step. This significantly shortens the time required to complete the production of the targeting vector. Furthermore, for more efficient phenotypic evaluation of the mutant parasites, a fluorescent protein (RFP) cassette is introduced into the targeting vector in which RFP is under the control of the constitutive eef1a promoter. This allows for a more rapid assessment of parasite growth in all of its developmental stages. In addition, the introduction of the fluorescent marker via the replacement strategy confers the stable integration of the marker.
Additional remarks selection procedure
top of page
Other details transgene
top of page
Promoter
Gene Model of Parasite PBANKA_1133300
Gene Model P. falciparum ortholog PF3D7_1357100
Gene productelongation factor 1-alpha
Gene product: Alternative nameeef1a
Primer information details of the primers used for amplification of the promoter sequence  Click to view information
Primer information details of the primers used for amplification of the promoter sequence  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
top of page
3'-UTR
Gene Model of Parasite PBANKA_0719300
Gene productbifunctional dihydrofolate reductase-thymidylate synthase, putative
Gene product: Alternative namedhfr/ts
Primer information details of the primers used for amplification the 3'-UTR sequences  Click to view information
Primer information details of the primers used for amplification the 3'-UTR sequences  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
Insertion/Replacement locus
Replacement / InsertionReplacement locus
Gene Model of Parasite PY04986
Gene productTRAP-related protein
Gene product: Alternative nameUOS3, up-regulated in ookinete sporozoites gene 3
Primer information details of the primers used for amplification of the target sequences  Click to view information
Primer information details of the primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1GGGATATCGCAATGTTAAACAAGCAATATGCTC
Additional information primer 1Pr.1 (EcoRV); 3'UTR TSR domain forward + amplification of the final PCR product
Sequence Primer 2TTGCCCTCCTGCAGGTTCGTGGTCTACACTTGTAT
Additional information primer 2Pr.2 (SbfI); 3'UTR TSR domain reverse + annealing of 5'UTR and 3'UTR
Sequence Primer 3GTGGTTTACCTGCAGGAGGGCAATTTGTATCATATGACC
Additional information primer 3Pr.3 (SbfI); 5'UTR TSR domain forward + annealing of 5'UTR and 3'UTR
Sequence Primer 4ATGCGGCCGCGCTGTATAGTTTTTTGAAAGTGGAG
Additional information primer 4Pr.4 (NotI); 5'UTR TSR domain reverse + amplification of the final PCR product
top of page
Conceptual design of the database: Dr. C.J. Janse (Leiden Malaria Research Group, Leiden, The Netherlands).
Technical design and realization: S. Mededovic and A. van Wigcheren