Summary

RMgm-256
Malaria parasiteP. berghei
Genotype
DisruptedGene model (rodent): PBANKA_1229800; Gene model (P.falciparum): PF3D7_0615100; Gene product: enoyl-acyl carrier reductase (FABI)
PhenotypeNo phenotype has been described
Last modified: 12 April 2009, 11:26
  *RMgm-256
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene disruption
Reference (PubMed-PMID number) Not published (yet)
MR4 number
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone P. berghei ANKA cl15cy1
Other information parent lineA reference wild type clone from the ANKA strain of P. berghei (PubMed: PMID: 17406255).
The mutant parasite was generated by
Name PI/ResearcherD.A. Fidock, C.J. Janse
Name Group/DepartmentDepartment of Microbiology
Name InstituteColumbia University
CityNew York
CountryUSA
Name of the mutant parasite
RMgm numberRMgm-256
Principal name1284cl1, 1284cl4
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
Phenotype
Asexual blood stageNot different from wild type
Gametocyte/GameteNot tested
Fertilization and ookineteNot tested
OocystNot tested
SporozoiteNot tested
Liver stageNot tested
Additional remarks phenotype

Mutant/mutation
The mutant lacks expression of FABI. The mutant has been generated using the same DNA construct to generate the published mutant RMgm-197.

Protein (function)
FABI is an enzyme of the bacterial like type II fatty acid biosynthesis (FAS-II) pathway. In Plasmodium FAS-II enzymes have been localized to the apicoplast, a nonphotosynthetic plastid organelle of cyanobacterial origin.
FAS-II requires acetyl-Coenzyme A (CoA), which can be converted from pyruvate by the pyruvate dehydrogenase complex. Acetyl-CoA carboxylase converts acetyl-CoA to malonyl-CoA, which is tethered to an acyl carrier protein (ACP) by malonyl-CoA:ACP transacylase (FabD). This produces malonyl-ACP, which, in conjunction with acetyl-CoA, is acted upon by β-ketoacyl-ACP synthase III (Fab H) to form β-ketoacyl-ACP. This precursor enters the FAS-II elongation cycle, mediated by FabB/F (β-ketoacyl-acyl-carrier-protein (ACP) synthase), FabG (β-ketoacyl-ACP reductase), FabZ/A (β-hydroxyacyl-ACP dehydratase), and FabI (trans-2-enoyl-ACP reductase). These four FAS-II enzymes iteratively catalyze the addition of two carbon chains to a growing fatty acyl carbon chain via condensation, reduction, dehydration, and reduction steps, respectively.

The phenotype analyses of another mutant lacking FABI.(RMgm-197) show that FABI is not essential for blood stage development, mosquito stage development and initial infection of the liver. The results indicate a key role of FABI in the formation of infective liver stage merozoites demonstrating the importance of FASII pathway for synthesis of fatty acids during late liver stage development.

Phenotype
The phenotype has not been analysed in detail. The mutant has been generated using the same DNA construct to generate the published mutant RMgm-197. See RMgm-197 for a detailed description of the phenotype of a mutant lacking FABI.

Additional information

Other mutants
RMgm-197: A mutant lacking expression of FABI
RMgm-180: A mutant expressing myc tagged FABI


  Disrupted: Mutant parasite with a disrupted gene
Details of the target gene
Gene Model of Rodent Parasite PBANKA_1229800
Gene Model P. falciparum ortholog PF3D7_0615100
Gene productenoyl-acyl carrier reductase
Gene product: Alternative nameFABI
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct usedPlasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid SnaBI/AhdI
Partial or complete disruption of the geneComplete
Additional remarks partial/complete disruption
Selectable marker used to select the mutant parasitetgdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modification
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1CTTACTAGTGTTCAGAAGAAAAATACAAATAAGGTGG
Additional information primer 1MP8 (SpeI) pbfabI 5' UTR (F)
Sequence Primer 2CTTAGATCTCTATTAACAATAATATTGTTTACTATTTTCG
Additional information primer 2MP9 (BglII) pbfabI 5' UTR (R)
Sequence Primer 3CTTGGTACCCCTTTCATTCTCTTTCTCACTCTATTC
Additional information primer 3MP10 (KpnI) pbfabI 3' UTR (F)
Sequence Primer 4CTTAGGCCTTTTAAACTTTCTCATTTCCAATTAACTGC
Additional information primer 4MP11 (StuI) pbfabI 3' UTR (R)
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6