RMgmDB - Rodent Malaria genetically modified Parasites

Summary

RMgm-233
Malaria parasiteP. berghei
Genotype
DisruptedGene model (rodent): PBANKA_1006200; Gene model (P.falciparum): PF3D7_0408600; Gene product: sporozoite invasion-associated protein 1 (Sporozoite Invasion-Associated Protein-1; SIAP-1; SIAP-1/ag17/S5)
Phenotype Oocyst; Sporozoite; Liver stage;
Last modified: 24 April 2009, 09:03
  *RMgm-233
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene disruption
Reference (PubMed-PMID number) Reference 1 (PMID number) : 19181869
MR4 number
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei NK65
Name parent line/clone Not applicable
Other information parent lineA second mutant lacking expression of SIAP was generated in the P. berghei ANKA 507cl1 parent line. This parent line is a reference line of P.berghei ANKA that constitutively expresses GFP under control of the eukaryotic elongation factor-1a (eef1a) promoter of P. berghei (Janse et.al., (2006), Mol Biochemical Parasitology, 145: 60-70; see also RMgm-7).
The mutant parasite was generated by
Name PI/ResearcherS. Engelmann, K. Matuschewski
Name Group/DepartmentDepartment of Parasitology
Name InstituteHeidelberg University School of Medicine
CityHeidelberg
CountryGermany
Name of the mutant parasite
RMgm numberRMgm-233
Principal namesiap-1(-)
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
Phenotype
Asexual blood stageNot different from wild type
Gametocyte/GameteNot different from wild type
Fertilization and ookineteNot different from wild type
OocystNormal numbers of oocyst and oocyst-derived sporozoites are formed. In a significant fraction of mature oocysts the sporozoites did not egress from the oocysts resulting in reduced numbers of sporozoites in the hemocoel.
SporozoiteNormal numbers of oocyst and oocyst-derived sporozoites are formed. In a significant fraction of mature oocysts the sporozoites did not egress from the oocysts resulting in reduced numbers of sporozoites in the hemocoel. No sporozoites were detected in the salivary glands. Sporozoites show infrequent, non-productive motility.
Liver stageMice/rats could not be infected by the bite of mosquitoes infected with the mutant.
Only by intravenous injections of high numbers of sporozoites (50.000), blood stage infections developed in mice.
Additional remarks phenotype

Mutant/mutation
The mutant lacks expression of SIAP-1 (Sporozoite Invasion-Associated Protein-1).

Protein (function)
SIAP-1 orthologs have been found exclusively in apicomplexan hemoprotozoa, parasites that are transmitted by arthropod vectors, e.g., Plasmodium, Babesia, and Theileria species (and is absent in, for example,  Toxoplasma and Cryptosporidium).  SIAP1 was first discovered in a systematic screen for P. falciparum sporozoite antigens recognized by sera from individuals that were immunized with irradiated sporozoites and termed antigen 17 (ag17). Subsequently, the P. yoelii ortholog was isolated in a suppression subtractive hybridization screen for genes that are specifically upregulated in sporozoites (S5) compared to blood stages. Analyses of a mutant expressing (C-terminal) mCherry-tagged form of SIAP-1 (RMgm-232). showed specific expression of SIAP-1 in sporozoites and liver stages.

Phenotype
The phenotype analyses indicate a partial defect in the egress of sporozoites  from oocysts and indicate an additional effect on invasion of salivary glands. Sporozoites did not show gliding motility and a  complete block of sporozoite transmission from highly infected mosquitoes was observed.
See also the phenotype analyses of mutant RMgm-109 which indicate that sporozoites lacking expression of SIAP-1are not affected in infectivity.

Additional information
See also Vignali, M. et al. (2009, Genome Biology, 10:216) for a discussion on the slightly different phenotypes reported for mutant RMgm-109 and RMgm-233, RMgm-234.

Other mutants
RMgm-109: A mutant lacking expression SIAP-1
RMgm-232: A mutant expressing (C-terminal) mCherry-tagged form of SIAP-1
RMgm-234: A mutant lacking expression SIAP-1 that expresses GFP under control of the sporozoite specific csp promoter.


  Disrupted: Mutant parasite with a disrupted gene
Details of the target gene
Gene Model of Rodent Parasite PBANKA_1006200
Gene Model P. falciparum ortholog PF3D7_0408600
Gene productsporozoite invasion-associated protein 1
Gene product: Alternative nameSporozoite Invasion-Associated Protein-1; SIAP-1; SIAP-1/ag17/S5
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct usedPlasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid KpnI/SpeI
Partial or complete disruption of the geneComplete
Additional remarks partial/complete disruption
Selectable marker used to select the mutant parasitetgdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modification
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1GGGGTACCGTGTTTTCATGCTATATGTACATTTGC
Additional information primer 15’SIAP-1-Rep_for (KpnI); 5'
Sequence Primer 2CCCAAGCTTGATGATATTGACCGTAAAATCC
Additional information primer 25’SIAP-1-Rep_rev (HindIII); 5'
Sequence Primer 3CGGGATCCCCTATAGTTACAGTGTTTTCG
Additional information primer 35’SIAP-1-Rep_ for (BamHI); 3'
Sequence Primer 4GGACTAGTGTTCGATATACCTTGCAGATTCC
Additional information primer 45’SIAP-1-Rep_ rev (SpeI); 3'
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6