RMgmDB - Rodent Malaria genetically modified Parasites

Summary

RMgm-1112
Malaria parasiteP. berghei
Genotype
Transgene
Transgene not Plasmodium: Ovalbumin (OVA ) fused to mCherry
Promoter: Gene model: PBANKA_0711900; Gene model (P.falciparum): PF3D7_0818900; Gene product: heat shock protein 70 (HSP70)
3'UTR: Gene model: PBANKA_0711900; Gene product: heat shock protein 70 (HSP70)
Replacement locus: Gene model: PBANKA_0306000; Gene product: 6-cysteine protein (230p)
Phenotype Asexual bloodstage; Gametocyte/Gamete; Liver stage;
Last modified: 2 September 2014, 19:09
  *RMgm-1112
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Introduction of a transgene
Reference (PubMed-PMID number) Reference 1 (PMID number) : 25156724
MR4 number
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone RMgm-687
Other information parent lineGIMO-PbANKA (RMgm-687) contains as a selectable marker (SM) the fusion gene of hdhfr (human dihydrofolate reductase; positive SM) and yfcu (yeast cytosine deaminase and uridyl phosphoribosyl transferase; negative SM) stably integrated into the 230p locus (PBANKA_030600) through double cross-over recombination. The SM is under control of the P. berghei eef1α promoter. This reference line of P. berghei ANKA line is used for rapid introduction of transgenes free of drug-resistance genes (PubMed: PMID: 22216235).
The mutant parasite was generated by
Name PI/ResearcherLin JW; Janse CJ; Khan SM
Name Group/DepartmentLeiden Malaria Research Group, Parasitology
Name InstituteLeiden University Medical Centre
CityLeiden
CountryThe Netherlands
Name of the mutant parasite
RMgm numberRMgm-1112
Principal nameOVA::mCherry(hsp70)
Alternative name2027cl1
Standardized name
Is the mutant parasite cloned after genetic modificationYes
Phenotype
Asexual blood stagecytoplasmic OVA::mCherry expression
Gametocyte/Gametecytoplasmic OVA::mCherry expression
Fertilization and ookineteNot tested
OocystNot tested
SporozoiteNot tested
Liver stagecytoplasmic OVA::mCherry expression
Additional remarks phenotype

Mutant/mutation
The mutant expresses a fusion protein of OVA (ovalbumin) and mCherry under the constitutive hsp70 promoter.The mutant does not contain a drug-selectable marker.

The mutant has been generated and selected using the GIMO transfection method ('gene insertion/marker out') of transfection of a GIMO mother line that contains the hdhfr::yfcu selectable marker into the silent 230p locus.

The mutant has been generated in the reference line GIMOPbANKA (RMgm-687). This GIMO mother line is used for introduction of transgenes into the modified 230p locus through transfection with constructs that target the 230p locus. These constructs insert into the 230p locus (‘gene insertion’), thereby removing the hdhfr::yfcu selectable marker (‘marker out’) from the genome of the mother lines. Transgenic parasites that are marker-free are subsequently selected by applying negative drug selection using 5-FC. This selection procedure is performed in vivo in mice

Protein (function)

Phenotype
High expression of OVA::mCherry in all stages analysed (blood- and liver-stages).
These transgenic parasites were used to examine the effect of antigen subcellular-location and expression-level on the development of T-cell responses during blood-stage infections. Blood-stage parasite induced activation and proliferation of OVA-specific CD8+ T-cells (OT-I) and CD4+ T-cells (OT-II).

Evidence is presented that the location of OVA in parasites (cytosolic or at the parasitophorous vacuole membrane, PVM) influences the strength of T-cell responses. Parasites expressing OVA fused to the PVM protein HEP17 (RMgm-1116) induce stronger OVA-specific T-cell responses than parasites expressing cytosolic OVA-fused to mCherry. Parasites expressing unconjugated OVA showed low levels of OVA expression, indicating that unconjugated OVA is unstable. ....

Additional information

Other mutants

Parasites expressing OVA fused to the PVM protein HEP17 (RMgm-1116).
RMgm-1117 and RMgm-1118: OVA expressing parasites made in P. berghei NK65. These are comparable to the P. berghei ANKA OVA expressing parasites RMgm-1112 and RMgm-1116

Click on Ovalbumin for more rodent malaria mutants expressing OVA


  Transgene: Mutant parasite expressing a transgene
Type and details of transgene
Is the transgene Plasmodium derived Transgene: not Plasmodium
Transgene nameOvalbumin (OVA ) fused to mCherry
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct(Linear) plasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid
Selectable marker used to select the mutant parasitehdhfr/yfcu
Promoter of the selectable markereef1a
Selection (positive) procedureNo
Selection (negative) procedure5-fluorocytosine (5-FC)
Additional remarks genetic modificationThe CDS (without stop codon) of OVA was PCR-amplified from plasmid pENTRY201-OVA using primers 6466/6467 (CCCGCTCGAGATGGGCTCCATCGGTGCAG and CCGCGGATCCAGGGGAAACACATCTGCC) and cloned into the sites XhoI/BamHI of pL1809, resulting in placement of OVA between the hsp70 promoter region and the mCherry CDS
Additional remarks selection procedureThis reporter mutant expressing OVA::mCherry does not contain a drug-selectable marker.
The mutant has been generated in the reference line GIMOPbANKA (RMgm-678). The GIMO mother line is used for introduction of transgenes into the modified 230p locus through transfection with constructs that target the 230p locus. These constructs insert into the 230p locus (‘gene insertion’), thereby removing the hdhfr::yfcu selectable marker (‘marker out’) from the genome of the mother lines. Transgenic parasites that are marker-free are subsequently selected by applying negative drug selection using 5-FC. This selection procedure is performed in vivo in mice.
Other details transgene
Promoter
Gene Model of Parasite PBANKA_0711900
Gene Model P. falciparum ortholog PF3D7_0818900
Gene productheat shock protein 70
Gene product: Alternative nameHSP70
Primer information details of the primers used for amplification of the promoter sequence  Click to view information
Primer information details of the primers used for amplification of the promoter sequence  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
3'-UTR
Gene Model of Parasite PBANKA_0711900
Gene productheat shock protein 70
Gene product: Alternative nameHSP70
Primer information details of the primers used for amplification the 3'-UTR sequences  Click to view information
Primer information details of the primers used for amplification the 3'-UTR sequences  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
Insertion/Replacement locus
Replacement / InsertionReplacement locus
Gene Model of Parasite PBANKA_0306000
Gene product6-cysteine protein
Gene product: Alternative name230p
Primer information details of the primers used for amplification of the target sequences  Click to view information
Primer information details of the primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
Sequence Primer 3
Additional information primer 3
Sequence Primer 4
Additional information primer 4