RMgmDB - Rodent Malaria genetically modified Parasites

Back to search results

Summary

RMgm-1232
Malaria parasiteP. yoelii
Genotype
TaggedGene model (rodent): PY17X_1421600; Gene model (P.falciparum): PF3D7_1321600; Gene product: phosphodiesterase gamma, putative (PDEgamma; PDEγ)
Name tag: cMyc (4x)
Phenotype Asexual bloodstage; Sporozoite;
Last modified: 30 March 2015, 15:24
  *RMgm-1232
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene tagging
Reference (PubMed-PMID number) Reference 1 (PMID number) : 25784701
MR4 number
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. yoelii
Parent strain/lineP. y. yoelii 17XNL
Name parent line/clone Not applicable
Other information parent line
The mutant parasite was generated by
Name PI/ResearcherLakshmanan, V; Kappe, SH
Name Group/DepartmentSeattle Biomedical Research Institute
Name InstituteSeattle BioMed
CitySeattle, Washington
CountryUSA
Name of the mutant parasite
RMgm numberRMgm-1232
Principal namePDEγ-cMyc
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
Phenotype
Asexual blood stageImmunofluorescence analysys of the mutant expressing c-Myc tagged PDEγ showed PDEγ expression to be low in blood stages and high in salivary gland sporozoites. The expression in blood stages appeared internal and partially colocalized with the endoplasmic reticulum (ER) marker BiP. The protein also displayed an intracellular localization in sporozoites and high in salivary gland sporozoites. The expression in BS appeared internal and partially colocalized with the endoplasmic reticulum (ER) marker BiP. The protein also displayed an intracellular localization in sporozoites.
Gametocyte/GameteNot tested
Fertilization and ookineteNot tested
OocystNot tested
SporozoiteImmunofluorescence analysys of the mutant expressing c-Myc tagged PDEγ showed PDEγ expression to be low in blood stages and high in salivary gland sporozoites. The expression in blood stages appeared internal and partially colocalized with the endoplasmic reticulum (ER) marker BiP. The protein also displayed an intracellular localization in sporozoites and high in salivary gland sporozoites. The expression in BS appeared internal and partially colocalized with the endoplasmic reticulum (ER) marker BiP. The protein also displayed an intracellular localization in sporozoites.
Liver stageNot tested
Additional remarks phenotype

Mutant/mutation
The mutant expresses a C-terminal cMyc(4x)-tagged version of PDEγ

Protein (function)
The cyclic nucleotides cAMP and cyclic GMP (cGMP) function as signaling second messengers downstream of surface receptor-ligand interactions by activating cAMP-dependent protein kinase (PKA) and cGMP-dependent protein kinase (PKG), respectively. Signaling through cAMP and cGMP is regulated by phosphodiesterases (PDEs), metal ion-dependent enzymes that hydrolyze the 3"-phosphoester bond of cAMP and cGMP. The Plasmodium genome encodes four PDEs (α, β, γ, and δ).
PDEγ is predicted to be a 782-amino-acid type II membrane protein with six transmembrane domains. A search for the presence of domains using the PDE sequence on Prosite (http://prosite.expasy.org/) predicted the protein to possess the conserved catalytic domain amino acid signature H-D-I-g-H-f-G-r-t-N-m-F for PDEs.

Phenotype analyses of a mutant lacking expression of PDEγ (RMgm-1231) indicate an essential role for sporozoite motility (and invasion of salivary glands). Blood stages of the mutant show a slightly reduced growth rate.

Phenotype
Phenotype analyses of a mutant lacking expression of PDEγ (RMgm-1231) indicate an essential role for sporozoite motility (and invasion of salivary glands). Blood stages of the mutant show a slightly reduced growth rate.

Immunofluorescence analysys of the mutant expressing c-Myc tagged PDEγ showed PDEγ expression to be low in blood stages  and high in salivary gland sporozoites. The expression in blood stages appeared internal and partially colocalized with the endoplasmic reticulum (ER) marker BiP. The protein also displayed an intracellular localization in sporozoites and high in salivary gland sporozoites. The expression in BS appeared internal and partially colocalized with the endoplasmic reticulum (ER) marker BiP. The protein also displayed an intracellular localization in sporozoites.

Additional information

Other mutants
A mutant lacking expression of PDEγ (RMgm-1231)


  Tagged: Mutant parasite with a tagged gene
Details of the target gene
Gene Model of Rodent Parasite PY17X_1421600
Gene Model P. falciparum ortholog PF3D7_1321600
Gene productphosphodiesterase gamma, putative
Gene product: Alternative namePDEgamma; PDEγ
Details of the genetic modification
Name of the tagcMyc (4x)
Details of taggingC-terminal
Additional remarks: tagging
Commercial source of tag-antibodies
Type of plasmid/construct(Linear) plasmid single cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid
Selectable marker used to select the mutant parasitetgdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modificationThe tagging construct was designed to replace the endogenous locus with the tagged version of P. yoelii PDEγ by double crossover homologous recombination. P. yoelii 17XNL genomic DNA was used to amplify a 669-bp fragment of the 3' end of the coding sequence without the stop codon of P. yoelii PDEγ using oligonucleotide primers 5' GATAAATGACAAATTTACGGCCGAATCAATATTAGAGAATTATCATTGCTC (sense) and 5' ATACTAGTTAATTTATATATATTAAGATTTGGTGCATAAAC (antisense) and a 630-bp fragment of the 3' UTR with primers 3' ATCCGCGGCATGGAAAATTGTTTATGCACCAAATC (sense) and 5' CTAATATTGATTCGGCCGTAAATTTGTCATTTATCATATATATACATG (antisense). The two PCR products were fused by sequence overlap extension PCR (SOE PCR). The SOE PCR product was cloned into pCR-Blunt (Life Technologies), sequenced, digested with SacII and SpeI, gel purified using a gel extraction kit (Qiagen), and cloned into a modified version of plasmid pL0005 (MR4: MRA-774), pL0005-cMyc, which allowed tagging of proteins with a C-terminal quadruple Myc (4X Myc) tag. The final plasmid was linearized with EagI.
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
Sequence Primer 3
Additional information primer 3
Sequence Primer 4
Additional information primer 4
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6