top of page |
Details of the target gene |
Gene Model of Rodent Parasite |
PY17X_1421600
|
Gene Model P. falciparum ortholog |
PF3D7_1321600
|
Gene product | phosphodiesterase gamma, putative |
Gene product: Alternative name | PDEgamma; PDEγ |
top of page |
Details of the genetic modification |
Name of the tag | cMyc (4x) |
Details of tagging | C-terminal |
Additional remarks: tagging | |
Commercial source of tag-antibodies | |
Type of plasmid/construct | (Linear) plasmid single cross-over |
PlasmoGEM (Sanger) construct/vector used | No |
Modified PlasmoGEM construct/vector used | No
|
Plasmid/construct map |
|
Plasmid/construct sequence |
|
Restriction sites to linearize plasmid |
|
Selectable marker used to select the mutant parasite | tgdhfr |
Promoter of the selectable marker | pbdhfr |
Selection (positive) procedure | pyrimethamine |
Selection (negative) procedure | No |
Additional remarks genetic modification | The tagging construct was designed to replace the endogenous locus with the tagged version of P. yoelii PDEγ by double crossover homologous recombination. P. yoelii 17XNL genomic DNA was used to amplify a 669-bp fragment of the 3' end of the coding sequence without the stop codon of P. yoelii PDEγ using oligonucleotide primers 5' GATAAATGACAAATTTACGGCCGAATCAATATTAGAGAATTATCATTGCTC (sense) and 5' ATACTAGTTAATTTATATATATTAAGATTTGGTGCATAAAC (antisense) and a 630-bp fragment of the 3' UTR with primers 3' ATCCGCGGCATGGAAAATTGTTTATGCACCAAATC (sense) and 5' CTAATATTGATTCGGCCGTAAATTTGTCATTTATCATATATATACATG (antisense). The two PCR products were fused by sequence overlap extension PCR (SOE PCR). The SOE PCR product was cloned into pCR-Blunt (Life Technologies), sequenced, digested with SacII and SpeI, gel purified using a gel extraction kit (Qiagen), and cloned into a modified version of plasmid pL0005 (MR4: MRA-774), pL0005-cMyc, which allowed tagging of proteins with a C-terminal quadruple Myc (4X Myc) tag. The final plasmid was linearized with EagI. |
Additional remarks selection procedure | |
Primer information: Primers used for amplification of the target sequences
Primer information: Primers used for amplification of the target sequences
Sequence Primer 1 | |
Additional information primer 1 | |
Sequence Primer 2 | |
Additional information primer 2 | |
Sequence Primer 3 | |
Additional information primer 3 | |
Sequence Primer 4 | |
Additional information primer 4 | |
Sequence Primer 5 | |
Additional information primer 5 | |
Sequence Primer 6 | |
Additional information primer 6 | |
|
|
top of page |