Back to search resultsSummaryRMgm-1231
|
Successful modification | The parasite was generated by the genetic modification |
The mutant contains the following genetic modification(s) | Gene disruption, Introduction of a transgene |
Reference (PubMed-PMID number) |
Reference 1 (PMID number) : 25784701 |
MR4 number | |
top of page | |
Parent parasite used to introduce the genetic modification | |
Rodent Malaria Parasite | P. yoelii |
Parent strain/line | P. y. yoelii 17XNL |
Name parent line/clone | Not applicable |
Other information parent line | |
top of page | |
The mutant parasite was generated by | |
Name PI/Researcher | Lakshmanan, V; Kappe, SH |
Name Group/Department | Seattle Biomedical Research Institute |
Name Institute | Seattle BioMed |
City | Seattle, Washington |
Country | USA |
top of page | |
Name of the mutant parasite | |
RMgm number | RMgm-1231 |
Principal name | pdeγ(-) |
Alternative name | |
Standardized name | |
Is the mutant parasite cloned after genetic modification | Yes |
top of page | |
Phenotype | |
Asexual blood stage | Slightly reduced growth rate of blood stages |
Gametocyte/Gamete | Not different from wild type |
Fertilization and ookinete | Not different from wild type |
Oocyst | Not different from wild type |
Sporozoite | Normal number of oocyst-derived sporozoites are produced. In contrast, salivary gland sporozoite numbers in pdeγ(-) infected mosquitoes were ~55-fold lower than in wild type infected mosquitoes. Sporozoites show a strongly reduced gliding motility |
Liver stage | Normal number of oocyst-derived sporozoites are produced. In contrast, salivary gland sporozoite numbers in pdeγ(-) infected mosquitoes were ~55-fold lower than in wild type infected mosquitoes. Sporozoites show a strongly reduced gliding motility No liver infection after infection of mice by mosquito bite. After intravenous injection of large numbers of sporozoites a low percentage of mice develop blood stage infections (with prolonged prepatent periods) |
Additional remarks phenotype | Mutant/mutation |
top of page | |||||||||||||||||||||||||
Details of the target gene | |||||||||||||||||||||||||
Gene Model of Rodent Parasite | PY17X_1421600 | ||||||||||||||||||||||||
Gene Model P. falciparum ortholog | PF3D7_1321600 | ||||||||||||||||||||||||
Gene product | phosphodiesterase gamma, putative | ||||||||||||||||||||||||
Gene product: Alternative name | PDEgamma; PDEγ | ||||||||||||||||||||||||
top of page | |||||||||||||||||||||||||
Details of the genetic modification | |||||||||||||||||||||||||
Inducable system used | No | ||||||||||||||||||||||||
Additional remarks inducable system | |||||||||||||||||||||||||
Type of plasmid/construct used | (Linear) plasmid double cross-over | ||||||||||||||||||||||||
PlasmoGEM (Sanger) construct/vector used | No | ||||||||||||||||||||||||
Modified PlasmoGEM construct/vector used | No | ||||||||||||||||||||||||
Plasmid/construct map | |||||||||||||||||||||||||
Plasmid/construct sequence | |||||||||||||||||||||||||
Restriction sites to linearize plasmid | |||||||||||||||||||||||||
Partial or complete disruption of the gene | Complete | ||||||||||||||||||||||||
Additional remarks partial/complete disruption | |||||||||||||||||||||||||
Selectable marker used to select the mutant parasite | tgdhfr | ||||||||||||||||||||||||
Promoter of the selectable marker | pbdhfr | ||||||||||||||||||||||||
Selection (positive) procedure | pyrimethamine | ||||||||||||||||||||||||
Selection (negative) procedure | No | ||||||||||||||||||||||||
Additional remarks genetic modification | P. yoelii 17XNL genomic DNA was used to amplify a 658-bp fragment of the 3'-untranslated region (UTR) using oligonucleotide primers 5' GCGAGCTCGGTACCTATGCGTATAATATTATATGAATAAGAC (sense) and 5' CATGATATATAACCCTGCAGGTTAACTTGTTTTTATGGAAATTTAAAACC (antisense) and a 566-bp fragment of the 5' UTR with primers 5' CATAAAAACAAGTTAACCTGCAGGGTTATATATCATGGAATTTCGTTGCAC (sense) and 5' ATGCGGCCGCTATCGTTTGACACGAATAAATTTAATCG (antisense) of P. yoelii PDEγ (PyPDEγ). The two PCR products were fused by sequence overlap extension PCR (SOE PCR). The SOE PCR product was cloned into pCR-Blunt (Life Technologies), sequenced, digested with KpnI and NotI, gel purified using a gel extraction kit (Qiagen), and cloned into a modified version of plasmid pL0005 (MR4: MRA-774) ontaining GFPmut2 under the control of the constitutive P. berghei elongation factor 1 alpha promoter. The final plasmid was linearized with SbfI. Transfection of P. yoelii 17XNL parasites using the Amaxa Nucleofector device (Lonza) and selection of resistant parasites were conducted as previously described | ||||||||||||||||||||||||
Additional remarks selection procedure | |||||||||||||||||||||||||
Primer information: Primers used for amplification of the target sequences
Primer information: Primers used for amplification of the target sequences
| |||||||||||||||||||||||||
top of page |
top of page | |||||||||||||||||||
Type and details of transgene | |||||||||||||||||||
Is the transgene Plasmodium derived | Transgene: not Plasmodium | ||||||||||||||||||
Transgene name | GFP | ||||||||||||||||||
top of page | |||||||||||||||||||
Details of the genetic modification | |||||||||||||||||||
Inducable system used | No | ||||||||||||||||||
Additional remarks inducable system | |||||||||||||||||||
Type of plasmid/construct | (Linear) plasmid double cross-over | ||||||||||||||||||
PlasmoGEM (Sanger) construct/vector used | No | ||||||||||||||||||
Modified PlasmoGEM construct/vector used | No | ||||||||||||||||||
Plasmid/construct map | |||||||||||||||||||
Plasmid/construct sequence | |||||||||||||||||||
Restriction sites to linearize plasmid | |||||||||||||||||||
Selectable marker used to select the mutant parasite | tgdhfr | ||||||||||||||||||
Promoter of the selectable marker | pbdhfr | ||||||||||||||||||
Selection (positive) procedure | pyrimethamine | ||||||||||||||||||
Selection (negative) procedure | No | ||||||||||||||||||
Additional remarks genetic modification | |||||||||||||||||||
Additional remarks selection procedure | |||||||||||||||||||
top of page | |||||||||||||||||||
Other details transgene | |||||||||||||||||||
top of page | |||||||||||||||||||
Promoter | |||||||||||||||||||
Gene Model of Parasite | PBANKA_1133300 | ||||||||||||||||||
Gene Model P. falciparum ortholog | PF3D7_1357100 | ||||||||||||||||||
Gene product | elongation factor 1-alpha | ||||||||||||||||||
Gene product: Alternative name | eef1a | ||||||||||||||||||
| |||||||||||||||||||
top of page | |||||||||||||||||||
3'-UTR | |||||||||||||||||||
Gene Model of Parasite | PBANKA_0719300 | ||||||||||||||||||
Gene product | bifunctional dihydrofolate reductase-thymidylate synthase, putative | ||||||||||||||||||
Gene product: Alternative name | dhfr/ts | ||||||||||||||||||
| |||||||||||||||||||
Insertion/Replacement locus | |||||||||||||||||||
Replacement / Insertion | Replacement locus | ||||||||||||||||||
Gene Model of Parasite | PY17X_1421600 | ||||||||||||||||||
Gene product | phosphodiesterase gamma, putative | ||||||||||||||||||
Gene product: Alternative name | PDEgamma | ||||||||||||||||||
| |||||||||||||||||||
top of page |