RMgmDB - Rodent Malaria genetically modified Parasites

Back to search results

Summary

RMgm-151

Malaria parasite	P. berghei
Genotype
Mutated	Gene model (rodent): PBANKA_1349800; Gene model (P.falciparum): PF3D7_1335900; Gene product: thrombospondin-related anonymous protein \| sporozoite surface protein 2 (sporozoite surface protein 2; SSP2; SSP-2; TRAP) Details mutation: The cytoplasmic tail domain (CTD) of P. berghei TRAP replaced with the CTD of TRAP of P. falciparum
Phenotype	Sporozoite; Liver stage;

Last modified: 4 March 2010, 23:42

*RMgm-151

Successful modification	The parasite was generated by the genetic modification
The mutant contains the following genetic modification(s)	Gene mutation
Reference (PubMed-PMID number)	Reference 1 (PMID number) : 18441124
MR4 number
top of page
Parent parasite used to introduce the genetic modification
Rodent Malaria Parasite	P. berghei
Parent strain/line	P. berghei NK65
Name parent line/clone	Not applicable
Other information parent line
top of page
The mutant parasite was generated by
Name PI/Researcher	K. Heiss, K. Matuschewski
Name Group/Department	Department of Parasitology
Name Institute	Heidelberg University School of Medicine
City	Heidelberg
Country	Germany
top of page
Name of the mutant parasite
RMgm number	RMgm-151
Principal name	PfTRAP (TRAP-tail)
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modification	Yes
top of page
Phenotype
Asexual blood stage	Not different from wild type
Gametocyte/Gamete	Not different from wild type
Fertilization and ookinete	Not different from wild type
Oocyst	Not different from wild type
Sporozoite	Normal numbers of midgut (oocyst-derived) and salivary gland sporozoites are produced. Sporozoites produced normal amounts of the mutated TRAP protein in comparison with TRAP expression in wild type parasites. Normal numbers of mature liver-schizonts in Huh7 cells. Infection of Sprague/Dawley rats by inoculation of 10.000 sporozoites consistently resulted in blood stage infections.
Liver stage	Normal numbers of mature liver-schizonts in Huh7 cells. Infection of Sprague/Dawley rats by inoculation of 10.000 sporozoites consistently resulted in blood stage infections.
Additional remarks phenotype	Mutant/mutation The mutant expresses a mutated form of TRAP. The cytoplasmic tail domain (CTD) of TRAP has been replaced with the CTD of the TRAP protein of P. falciparum (thrombospondin-related anonymous protein; PF13_0201). Protein (function) TRAP is a type 1 transmembrane protein, containing two adhesive domains in its extracellular portion, an A-domain of von Willebrand factor and a thrombospondin type I repeat (TSR, TSP). The cytoplasmic part (tail) of the protein is postulated to interact with actin–myosin motor proteins giving the force needed for motility. TRAP is located in the micronemes of sporozoites. The protein plays a role in the gliding motility of sporozoites and invasion of host cells as has been shown by analysis of mutant parasites lacking expression of TRAP(RMgm-47; RMgm-53). Analyses of mutants that express TRAP with mutated forms of the cytoplasmic tail have shown the role of this domain for gliding motility and invasion of host cells (see 'Other mutants'). Phenotype Analyses of other mutants that express TRAP with mutated forms of the cytoplasmic tail have shown the role of this domain for gliding motility and invasion of host cells (see 'Other mutants'). The phenotype analyses of the mutant described here indicate that that the cytoplasmic tail domain of the TRAP protein of P. falciparum (thrombospondin-related anonymous protein; PF13_0201) can fully complement the function of cytoplasmic tail domain of P. berghei TRAP. Additional information Other mutants P. berghei mutants with mutated cytoplasmic tails of TRAP (RMgm-54; RMgm-55; RMgm-56; RMgm-57; RMgm-149; RMgm-150).

Mutated: Mutant parasite with a mutated gene

top of page

Details of the target gene

Gene Model of Rodent Parasite

PBANKA_1349800

Gene Model P. falciparum ortholog

PF3D7_1335900

Gene product

thrombospondin-related anonymous protein | sporozoite surface protein 2

Gene product: Alternative name

sporozoite surface protein 2; SSP2; SSP-2; TRAP

top of page

Details of the genetic modification

Short description of the mutation

The cytoplasmic tail domain (CTD) of P. berghei TRAP replaced with the CTD of TRAP of P. falciparum

Inducable system used

Short description of the conditional mutagenesis

Not available

Additional remarks inducable system

Type of plasmid/construct

Plasmid single cross-over

PlasmoGEM (Sanger) construct/vector used

Modified PlasmoGEM construct/vector used

Plasmid/construct map

Plasmid/construct sequence

Restriction sites to linearize plasmid

Selectable marker used to select the mutant parasite

pbdhfr

Promoter of the selectable marker

pbdhfr

Selection (positive) procedure

pyrimethamine

Selection (negative) procedure

Additional remarks genetic modification

The construct used results in replacement of the wild type trap-gene with a mutated trap gene. In the mutated trap gene the cytoplasmic tail domain (CTD) of P. berghei TRAP is replaced with the CTD of the TRAP protein of P. falciparum (thrombospondin-related anonymous protein; PF13_0201). The CTD of P. falciparum TRAP was obtained using the following primers: PfTRAPfor (5' CGGGATCCGCAGCAACACCCTATGCCGGAGAACC 3' and PfTRAPrev (5' TGCTCTAGATTAATTCCACTCGTTTTCTTCAGG 3'. The mutated TRAP gene is under the control of the 5'-UTR of TRAP and the 3'-UTR of pbdhfr.

Additional remarks selection procedure

Primer information: Primers used for amplification of the target sequences Click to view information

Primer information: Primers used for amplification of the target sequences Click to hide information

Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
Sequence Primer 3
Additional information primer 3
Sequence Primer 4
Additional information primer 4
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6

top of page