RMgmDB - Rodent Malaria genetically modified Parasites

Summary

RMgm-95
Malaria parasiteP. berghei
Genotype
DisruptedGene model (rodent): PBANKA_0701900; Gene model (P.falciparum): PF3D7_0828800; Gene product: GPI-anchored micronemal antigen (PSOP9; putative secreted ookinete protein 9; GAMA)
Phenotype Fertilization and ookinete; Oocyst; Sporozoite; Liver stage;
Last modified: 9 September 2011, 11:32
  *RMgm-95
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene disruption
Reference (PubMed-PMID number) Reference 1 (PMID number) : 18761621
MR4 number
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone P. berghei ANKA 2.34
Other information parent lineP. berghei ANKA 2.34 is a cloned, gametocyte producer line of the ANKA strain (PubMed: PMID: 15137943).
The mutant parasite was generated by
Name PI/ResearcherA. Ecker; R.E. Sinden
Name Group/DepartmentDivision of Cell and Molecular Biology
Name InstituteImperial College
CityLondon
CountryUnited Kingdom
Name of the mutant parasite
RMgm numberRMgm-95
Principal name∆psop9
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
Phenotype
Asexual blood stageNot different from wild type
Gametocyte/GameteNot different from wild type
Fertilization and ookineteNormal production of ookinetes. Possibly a reduced ookinete invasion and traversal of the midgut wall.
OocystReduced numbers of oocysts: 22% of wild type (9-41%). Oocysts formed are morphologically indistinguishable from wild type oocysts. Sporozoites persist within oocysts at least until day 30 of infection, and fail to produce salivary gland infections.
SporozoiteSporozoites persist within oocysts at least until day 30 of infection, and fail to produce salivary gland infections, resulting in strongly reduced numbers of salivary gland sporozoites: 0.3% of wild type (0.0-0.7%). No transmission to C57BL/6 mice by bite of infected mosquitoes.
Liver stageSee also the phenotype of sporozoites.
No transmission to C57BL/6 mice by bite of infected mosquitoes. Injection of large numbers of midgut sporozoites (500.000) into C57BL/6 mice did not result in a blood stage infection.
Additional remarks phenotype

Mutant/mutation
The mutant lacks expression of PSOP9 (putative secreted ookinete protein).

Protein (function)
Unknown. The protein is detected in a proteome analysis of ookinetes and contains a predicted signal sequence.

Phenotype
The phenotype anlyses indicate a role during the transition of ookinete to oocyst and oocyst development. The mutants produces significant reduced numbers of oocysts and in addition a significantly reduced numbers of salivary gland sporozoites. Oocysts formed are morphologically indistinguishable from wild type oocysts and produce up to 85% of the wt number of midgut sporozoites, which express circumsporozoite (CS) protein on their surface.  Sporozoites persist within oocysts at least until day 30 of infection, suggesting that their egress might be impaired. Midgut sporozoites were not infective to C57Bl/6 mice

Additional information
PSOP9 was detected by mass spectroscopy in all three invasive parasite stages, in P. berghei ABS (with low confidence), P. falciparum schizonts and merozoites and on the infected RBC membrane, in P. berghei ookinetes and in P. falciparum sporozoites (Florens et al., 2002; 2004; Hall et al., 2005; J. D. Raine unpubl. data).  However, its function in the ABS is clearly dispensable as KO parasites were readily obtained.

It has been reported that the P. falciparum ortholog,  PF08_0008,  is refractory to gene knockout attempts (Arumugam TU, 2011, Infect. Immun.; PMID: 21896773.


  Disrupted: Mutant parasite with a disrupted gene
Details of the target gene
Gene Model of Rodent Parasite PBANKA_0701900
Gene Model P. falciparum ortholog PF3D7_0828800
Gene productGPI-anchored micronemal antigen
Gene product: Alternative namePSOP9; putative secreted ookinete protein 9; GAMA
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct usedPlasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid
Partial or complete disruption of the geneComplete
Additional remarks partial/complete disruption
Selectable marker used to select the mutant parasitetgdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modification
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1TTGGGCCCATTTTATATACCCGTAATTAATG
Additional information primer 1AE09a (ApaI); 5'
Sequence Primer 2CCAAGCTTTAACATATAAATATATATACACC
Additional information primer 2AE09b (HindIII); 5'
Sequence Primer 3TGAATTCGTATCATGCTATTTATTACATAC
Additional information primer 3AE09c (EcoRI); 3'
Sequence Primer 4GGGGATCCAGGAAATACAAATTAGAATAACC
Additional information primer 4AE09d (BamHI); 3'
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6