RMgmDB - Rodent Malaria genetically modified Parasites

Summary

RMgm-878
Malaria parasiteP. berghei
Genotype
TaggedGene model (rodent): PBANKA_0417600; Gene model (P.falciparum): PF3D7_0903800; Gene product: LCCL domain-containing protein (CCp4; LAP6)
Name tag: EGFP
Phenotype Fertilization and ookinete;
Last modified: 1 June 2013, 22:51
  *RMgm-878
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene tagging
Reference (PubMed-PMID number) Reference 1 (PMID number) : 23684590
MR4 number
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone Not applicable
Other information parent line
The mutant parasite was generated by
Name PI/ResearcherSaeed, S; Dessens, T
Name Group/DepartmentDepartment of Pathogen Molecular Biology, Faculty of Infectious and Tropical Diseases
Name InstituteLondon School of Hygiene & Tropical Medicine
CityLondon
CountryUK
Name of the mutant parasite
RMgm numberRMgm-878
Principal namePbLAP6/GFP
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
Phenotype
Asexual blood stageNot different from wild type
Gametocyte/GameteNot different from wild type
Fertilization and ookineteGFP expression in ookinetes. Ookinetes exhibited GFP-based fluorescence that typically distributed to 2–3 regions visibly associated with clusters of malariapigment, characteristic of crystalloid targeting
OocystNot different from wild type
SporozoiteNot tested
Liver stageNot tested
Additional remarks phenotype

Mutant/mutation
The mutant expresses a C-terminal GFP-tagged version of LAP6 (CCp4). The tagged gene is under the control of the lap4 promoter region and the pbdhfr 3'UTR.

Protein (function)
The lap6 (ccp4) gene is a member of a small conserved gene family (6 genes), encoding proteins with multiple adhesive domains, for example a Lgl1 (LCCL)-lectin adhesive domain. In P. falciparum the LCCL domain-containing proteins are termed PfCCp's and in P. berghei PbLAP's

Phenotype
GFP expression in ookinetes. Ookinetes exhibited GFP-based fluorescence that typically distributed to 2–3 regions visibly associated with clusters of malaria-pigment, characteristic of crystalloid targeting.
No GFP expression in gametocytes and mature oocysts. mRNA is present in mature gametocytes indicating translational repression in gametocytes.

Additional information
Evidence has been presented in different studies for protein expression of LAP1, LAP2, LAP3 in gametocytes and ookinetes whereas protein expression of LAP4, LAP5 and LAP6 is absent in gametocytes. All proteins are associated with crystalloid bodies in ookinetes. See also mutants with different lap genes deleted: all these gene deletion studies show a defect during oocyst/sporozoite development.

Other mutants


  Tagged: Mutant parasite with a tagged gene
Details of the target gene
Gene Model of Rodent Parasite PBANKA_0417600
Gene Model P. falciparum ortholog PF3D7_0903800
Gene productLCCL domain-containing protein
Gene product: Alternative nameCCp4; LAP6
Details of the genetic modification
Name of the tagEGFP
Details of taggingC-terminal
Additional remarks: tagging
Commercial source of tag-antibodies
Type of plasmid/constructPlasmid single cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid
Selectable marker used to select the mutant parasitehdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modificationTo achieve GFP-tagging of PbLAP6 we adopted a strategy of single crossover homologous recombination. A ca. 1.9 kb fragment of pblap6 corresponding to the 3-part of the coding sequence was PCR amplified from genomic DNA with primers P1 (ACGAAGTTATCAGTCGACAGCCCCAGTTCAGACATAAAC) and P2 (ATGAGGGCCCCTAAGCTTTCTTTATGAGGAATAAATAAAATGTTTTTAAAC) and introduced into SalI/HindIII-digested pDNR-EGFP via in-fusion cloning(Takara Biotech) to give plasmid pDNR-PbLAP6/EGFP. The pblap6/egfp specific sequence was then transferred to pLP-hDHFR via cre-loxp recombination to give plasmid pLP-PbLAP6/EGFP
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1ACGAAGTTATCAGTCGACAGCCCCAGTTCAGACATAAAC
Additional information primer 1P1
Sequence Primer 2ATGAGGGCCCCTAAGCTTTCTTTATGAGGAATAAATAAAATGTTTTTAAAC
Additional information primer 2P2
Sequence Primer 3
Additional information primer 3
Sequence Primer 4
Additional information primer 4
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6