RMgmDB - Rodent Malaria genetically modified Parasites

Summary

RMgm-87
Malaria parasiteP. berghei
Genotype
DisruptedGene model (rodent): PBANKA_1228900; Gene model (P.falciparum): PF3D7_0801300; Gene product: von Willebrand factor A domain-related protein (WARP)
PhenotypeNo phenotype has been described
Last modified: 18 February 2009, 01:12
  *RMgm-87
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene disruption
Reference (PubMed-PMID number) Reference 1 (PMID number) : 18761621
MR4 number
top of page
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone P. berghei ANKA 2.34
Other information parent lineP. berghei ANKA 2.34 is a cloned, gametocyte producer line of the ANKA strain (PubMed: PMID: 15137943).
top of page
The mutant parasite was generated by
Name PI/ResearcherA. Ecker; R.E. Sinden
Name Group/DepartmentDivision of Cell and Molecular Biology
Name InstituteImperial College
CityLondon
CountryUnited Kingdom
top of page
Name of the mutant parasite
RMgm numberRMgm-87
Principal nameΔwarp
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
top of page
Phenotype
Asexual blood stageNot different from wild type
Gametocyte/GameteNot different from wild type
Fertilization and ookineteNot different from wild type
OocystNot different from wild type
SporozoiteNot different from wild type
Liver stageNot different from wild type
Additional remarks phenotype

Mutant/mutation
The mutant lacks expression of von willebrand factor A-domain-related protein (WARP)

Protein (function)
WARP is a conserved micronemal protein expressed in ookinetes (micronemes). The protein is mainly composed of a von Willebrand factor type A module-like domain (A domain) that is known to participate in cell–cell interactions, cell–matrix interactions, and matrix formation in several proteins. Expression of the protein starts in developing ookinetes, around 12 hours after fertilization.

Phenotype
The lack of expression of WARP does not result in a clear phenotype. In this study no in depht analysis of the phenotype of the different life cycle stages has been performed. Numbers of oocysts and salivary gland sporozoites were not significantly different in Anopheles stephensi compared to wild type. The mutant could 'easily be transmitted' by A. stephensi.

  Disrupted: Mutant parasite with a disrupted gene
top of page
Details of the target gene
Gene Model of Rodent Parasite PBANKA_1228900
Gene Model P. falciparum ortholog PF3D7_0801300
Gene productvon Willebrand factor A domain-related protein
Gene product: Alternative nameWARP
top of page
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct usedPlasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid
Partial or complete disruption of the geneComplete
Additional remarks partial/complete disruption
Selectable marker used to select the mutant parasitetgdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modification
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1GGGGTACCTTCCTGATTGTTCATACGGAAAG
Additional information primer 1AE03a (KpnI); 5'
Sequence Primer 2TTGGGCCCTATTTTTTGTGGGTGAGGAAAGC
Additional information primer 2AE03b (endogenous HindIII site); 5'
Sequence Primer 3TGAATTCAATGCCTTATTAGAAACCGAAAC
Additional information primer 3AE03c (EcoRI); 3'
Sequence Primer 4GGGGATCCCAAGCGCATTTAACCATTTTAAC
Additional information primer 4AE03d (BamHI); 3'
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6
top of page
Conceptual design of the database: Dr. C.J. Janse (Leiden Malaria Research Group, Leiden, The Netherlands).
Technical design and realization: S. Mededovic and A. van Wigcheren