RMgmDB - Rodent Malaria genetically modified Parasites

Summary

RMgm-83
Malaria parasiteP. berghei
Genotype
Genetic modification not successful
DisruptedGene model (rodent): PBANKA_1434400; Gene model (P.falciparum): PF3D7_1218800; Gene product: secreted ookinete protein, putative (PSOP17, putative secreted ookinete protein 17)
PhenotypeNo phenotype has been described
Last modified: 19 February 2009, 20:52
  *RMgm-83
Successful modificationThe gene/parasite could not be changed/generated by the genetic modification.
The following genetic modifications were attempted Gene disruption
Number of attempts to introduce the genetic modification 3
Reference (PubMed-PMID number) Reference 1 (PMID number) : 18761621
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone P. berghei ANKA 2.34
Other information parent lineP. berghei ANKA 2.34 is a cloned, gametocyte producer line of the ANKA strain (PubMed: PMID: 15137943).
Attempts to generate the mutant parasite were performed by
Name PI/ResearcherA. Ecker; R.E. Sinden
Name Group/DepartmentDivision of Cell and Molecular Biology
Name InstituteImperial College
CityLondon
CountryUnited Kingdom

  Disrupted: Mutant parasite with a disrupted gene
Details of the target gene
Gene Model of Rodent Parasite PBANKA_1434400
Gene Model P. falciparum ortholog PF3D7_1218800
Gene productsecreted ookinete protein, putative
Gene product: Alternative namePSOP17, putative secreted ookinete protein 17
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct usedPlasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid
Partial or complete disruption of the geneComplete
Additional remarks partial/complete disruption
Selectable marker used to select the mutant parasitetgdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modificationC-terminal c-myc tagging of the gene was successful, confirming that these gene loci can be targeted.
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1TTGGGCCCCAAAATTACCATTCTAATGCAAC
Additional information primer 1AE17a (ApaI); 5'
Sequence Primer 2CCAAGCTTCAGAATTTGAGCAATAACACTAG
Additional information primer 2AE17b (HindIII); 5'
Sequence Primer 3TGAATTCTCCATCAAAAATGTTTGCTTAAC
Additional information primer 3AE17c (EcoRI); 3'
Sequence Primer 4GGGGATCCATAAACGTGTGCATTTATGTGTG
Additional information primer 4AE17d (BamHI); 3'
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6