RMgmDB - Rodent Malaria genetically modified Parasites

Summary

RMgm-78
Malaria parasiteP. berghei
Genotype
Transgene
Transgene not Plasmodium: drFP583/DsRed/RFP, RedStar
Promoter: Gene model: PBANKA_0403200; Gene model (P.falciparum): PF3D7_0304600; Gene product: circumsporozoite (CS) protein (CSP)
3'UTR: Gene model: PBANKA_0719300; Gene product: bifunctional dihydrofolate reductase-thymidylate synthase, putative (DHFR/TS)
Insertion locus: Gene model: Not available; Gene product: Not available
Phenotype Sporozoite;
Last modified: 11 August 2009, 09:49
  *RMgm-78
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Introduction of a transgene
Reference (PubMed-PMID number) Reference 1 (PMID number) : 15901208
MR4 number MRA-905
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei NK65
Name parent line/clone Not applicable
Other information parent line
The mutant parasite was generated by
Name PI/ResearcherU. Frevert, H. Yee
Name Group/DepartmentDepartment of Medical and Molecular Parasitology
Name InstituteNew York University School of Medicine
CityNew York
CountryUSA
Name of the mutant parasite
RMgm numberRMgm-78
Principal nameRedStar P. berghei
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
Phenotype
Asexual blood stageNot different from wild type
Gametocyte/GameteNot different from wild type
Fertilization and ookineteNot different from wild type
OocystNot tested
SporozoiteSporozoites show strong (bright) RFP (RedStar) fluorescence
Liver stageNot tested
Additional remarks phenotype

Mutant/mutation
The mutant expresses RFP (RedStar)  under the control of the regulatory sequences of the gene encoding the circumsporozoite protein (CS).
RedStar was chosen because of its 10–20x enhanced brightness compared to RFP when expressed in mammalian cells.

Phenotype
RFP (RedStar) expression has no influence on sporozoite viability and infectivity.
This mutant has been used to analyse sporozoite biology. See Frevert, U. et al., 2005, PloS Biol. 3, e192.


  Transgene: Mutant parasite expressing a transgene
Type and details of transgene
Is the transgene Plasmodium derived Transgene: not Plasmodium
Transgene namedrFP583/DsRed/RFP, RedStar
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/constructPlasmid single cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid
Selectable marker used to select the mutant parasitepbdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modificationThe RedStar open reading frame was amplified from the plasmid PRS415-Gal1-RedStar with primers RFPfor (5' CGGGATCCAAAATGAGTAGATCTTCTAAGAAC 3' and RFPrev (5'GGACTAGTTTACAAGAACAAGTGGTGTCTACC 3'). RedStar was chosen because of its 10–20x enhanced brightness compared to RFP when expressed in mammalian cells.
The RFP (RedStar) gene is under control of the 5'UTR of the cs gene and the 3'UTR of the dhfr-ts gene of P. berghei. The construct is stably integrated into the genome. No information available on the insertion locus.
Additional remarks selection procedure
Other details transgene
Promoter
Gene Model of Parasite PBANKA_0403200
Gene Model P. falciparum ortholog PF3D7_0304600
Gene productcircumsporozoite (CS) protein
Gene product: Alternative nameCSP
Primer information details of the primers used for amplification of the promoter sequence  Click to view information
Primer information details of the primers used for amplification of the promoter sequence  Click to hide information
Sequence Primer 15' CCGGAATTCACATAAAAGGGAATATGGAATATACTAGC 3'
Additional information primer 1p5'CSEcoRIfor
Sequence Primer 25' CGCGGATCCAAATATATGCGTGTATATATAGATTTTG 3'
Additional information primer 2p5'CSBamHIrev
3'-UTR
Gene Model of Parasite PBANKA_0719300
Gene productbifunctional dihydrofolate reductase-thymidylate synthase, putative
Gene product: Alternative nameDHFR/TS
Primer information details of the primers used for amplification the 3'-UTR sequences  Click to view information
Primer information details of the primers used for amplification the 3'-UTR sequences  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
Insertion/Replacement locus
Replacement / InsertionInsertion locus
Gene Model of Parasite Not available
Gene productNot available
Gene product: Alternative name
Primer information details of the primers used for amplification of the target sequences  Click to view information
Primer information details of the primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
Sequence Primer 3
Additional information primer 3
Sequence Primer 4
Additional information primer 4