top of page |
Details of the target gene |
Gene Model of Rodent Parasite |
PBANKA_1355700
|
Gene Model P. falciparum ortholog |
PF3D7_1342600
|
Gene product | myosin A |
Gene product: Alternative name | MyoA; M-A |
top of page |
Details of the genetic modification |
Short description of the mutation | 'Promoter swap' mutant: the promoter of myosin A replaced by the promoter of ama1 (PBANKA_091500) |
Inducable system used | No |
Short description of the conditional mutagenesis | Not available |
Additional remarks inducable system |
|
Type of plasmid/construct | Plasmid double cross-over |
PlasmoGEM (Sanger) construct/vector used | No |
Modified PlasmoGEM construct/vector used | No
|
Plasmid/construct map |
|
Plasmid/construct sequence |
|
Restriction sites to linearize plasmid |
|
Selectable marker used to select the mutant parasite | hdhfr |
Promoter of the selectable marker | pbdhfr |
Selection (positive) procedure | pyrimethamine |
Selection (negative) procedure | No |
Additional remarks genetic modification | For the double-crossover promoter-exchange plasmid, a parent vector Pama1 was first constructed containing the ama1 promoter. For Pama1, 1.5 kb of the upstream sequence of the ama1 gene (PBANKA_083630) was cloned downstream of the hdhfr cassette in pDEFhDHPEA. The Pama1-myoA (pSS368) vector was subsequently made by inserting a myoA 5’ homology region upstream of the hdhfr cassette in Pama1 (consisting of 500 bp of myoA upstream sequence), and a 3’ homology region downstream of the ama1 promoter (consisting of the first 500 bp of myoA coding sequence) |
Additional remarks selection procedure | |
Primer information: Primers used for amplification of the target sequences
Primer information: Primers used for amplification of the target sequences
Sequence Primer 1 | gagaccgcggcattgaagaattgtattttgttac |
Additional information primer 1 | olSS1066; 5’HR MyoA forward |
Sequence Primer 2 | gagactgcagcgagaaacgagaaaaatcaaaatt |
Additional information primer 2 | olSS1067; 5’HR MyoA reverse |
Sequence Primer 3 | gagactcgagatggctgttacaaatgaggaat |
Additional information primer 3 | olSS1068; 3’HR MyoA forward |
Sequence Primer 4 | gagagcggccgcgttaacgccatgtaaatttgataaag |
Additional information primer 4 | olSS1069; 3’HR MyoA reverse |
Sequence Primer 5 | |
Additional information primer 5 | |
Sequence Primer 6 | |
Additional information primer 6 | |
|
|
top of page |