top of page |
Details of the target gene |
Gene Model of Rodent Parasite |
PBANKA_1126900
|
Gene Model P. falciparum ortholog |
PF3D7_0628200
|
Gene product | protein kinase PK4 | eukaryotic translation initiation factor 2-alpha kinase |
Gene product: Alternative name | PK4 |
top of page |
Details of the genetic modification |
Inducable system used | No |
Additional remarks inducable system |
|
Type of plasmid/construct used | Plasmid double cross-over |
PlasmoGEM (Sanger) construct/vector used | No |
Modified PlasmoGEM construct/vector used | No
|
Plasmid/construct map |
|
Plasmid/construct sequence |
|
Restriction sites to linearize plasmid |
|
Partial or complete disruption of the gene | Complete |
Additional remarks partial/complete disruption |
|
Selectable marker used to select the mutant parasite | hdhfr |
Promoter of the selectable marker | eef1a |
Selection (positive) procedure | pyrimethamine |
Selection (negative) procedure | No |
Additional remarks genetic modification | Unsuccessful attempts to disrupt the pk4 gene using standard methods of gene disruption (see RMgm-483; RMgm-566; RMgm-738; RMgm-739) indicate an essential role of PK4 during blood stage development.
See RMgm-737 for more information on PK4
Two 500-bp fragments of the PK4 N terminus and C terminus were cloned into the pBC_GFP_DHFR plasmid, and the targeting construct was named pBC_PbPK4KO construct (1) |
Additional remarks selection procedure | |
Primer information: Primers used for amplification of the target sequences
Primer information: Primers used for amplification of the target sequences
Sequence Primer 1 | agtacgctcgagatggaagaggatataaactgtaaag |
Additional information primer 1 | PK4koN_for |
Sequence Primer 2 | tggtacatcgatttctccattttactataatatattattttatg |
Additional information primer 2 | PK4koN_rev |
Sequence Primer 3 | acatgaaggcggccgcaaatttcattgaaagggcaaatgattg |
Additional information primer 3 | PK4koC_for |
Sequence Primer 4 | catgcaaggcgcgcccatatgatcaacttcatttccatt |
Additional information primer 4 | PK4koC_rev |
Sequence Primer 5 | |
Additional information primer 5 | |
Sequence Primer 6 | |
Additional information primer 6 | |
|
top of page |