RMgmDB - Rodent Malaria genetically modified Parasites

Summary

RMgm-634
Malaria parasiteP. berghei
Genotype
Transgene
Transgene not Plasmodium: GFP
Promoter: Gene model: PBANKA_1030100; Gene model (P.falciparum): PF3D7_1412500; Gene product: actin II (actin2)
3'UTR: Gene model: PBANKA_1340000; Gene product: dihydrofolate synthase/folylpolyglutamate synthase, putative (DHFS-FPGS)
Insertion locus: Gene model: Not available; Gene product: Not available
Phenotype Gametocyte/Gamete;
Last modified: 1 July 2012, 14:56
  *RMgm-634
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Introduction of a transgene
Reference (PubMed-PMID number) Reference 1 (PMID number) : 21790945
MR4 number
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone P. berghei ANKA 2.34
Other information parent lineP. berghei ANKA 2.34 is a cloned, gametocyte producer line of the ANKA strain (PubMed: PMID: 15137943).
The mutant parasite was generated by
Name PI/ResearcherE. Deligianni; I. Siden-Kiamos
Name Group/DepartmentInstitute of Molecular Biology and Biotechnology
Name InstituteFORTH
CityHeraklion
CountryGreece
Name of the mutant parasite
RMgm numberRMgm-634
Principal name5PbACT2-GFP
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
Phenotype
Asexual blood stageNot different from wild type
Gametocyte/GameteA GFP signal could be detected in both male and female activated gametes. After normalization for autofluorescence of non-GFP-expressing WT parasites, the fluorescence intensity of the males was about 9-fold stronger than that of females, while no signal was detected in asexual stages.
Fertilization and ookineteNot tested
OocystNot tested
SporozoiteNot tested
Liver stageNot tested
Additional remarks phenotype

Mutant/mutation
The mutant expresses GFP under control of 1.2kb of the promoter region of actin II and the 3'UTR regions of the dihydrofolate synthase/folylpolyglutamate synthase gene of P. berghei. The transgene is introduced in a locus on chromosome 12 between the genes PBANKA_122210 and PBANKA_122220.

Protein (function)
Actin, a cytoskeletal protein, has many diverse functions in eukaryotic cells ranging from roles in cell motility, cell division, vesicle trafficking to functions in cell signaling and regulation of transcription. A critical property of actin is its ability to form filamentous polymers (F-actin), and a plethora of proteins are involved in the highly dynamic regulation of F-actin formation . Actins are highly conserved proteins that often exist in multiple isoforms in the eukaryotic cell and their expression is regulated both spatially and temporally during development. The number of conventional actin genes varies among eukaryotic organisms. A few single cell eukaryotes, such as Saccharomyces cerevisiae, Toxoplasma gondii, and Trypanosoma brucei encode a single actin gene, which results in lethality when targeted with gene ablation approaches. Many organisms, however, have several conventional actin genes.Apicomplexan parasites all encode one major actin isoform, here termed Actin I. All apicomplexan parasites also contain a number of actin-related and actin-like proteins. Plasmodium species species stand out in that they all encode a second conventional actin, termed Actin II.
Phenotype analyses of mutants lacking expression of Actin II indicate a major role of Actin II in the formation of male gametes (see mutant RMgm-632).

Phenotype
Phenotype analyses of mutants lacking expression of Actin II indicate a major role of Actin II in the formation of male gametes (see mutant RMgm-632).
In the mutant that expresses GFP under the control of the promoter region of actin II a GFP signal could be detected in both male and female activated gametes. After normalization for autofluorescence of non-GFP-expressing WT parasites, the fluorescence intensity of the males was about 9-fold stronger than that of females, while no signal was detected in asexual stages.

Additional information
Phenotype analyses of a mutant expressing a GFP-tagged form of Actin II (mutant RMgm-633) indicates that GFP-tagged Actin II is expressed exclusively in male gametocytes/gametes.

Other mutants
RMgm-632: A mutant lacking expression of Actin II
RMgm-633: A mutant expressing a GFP-tagged form of Actin II
 


  Transgene: Mutant parasite expressing a transgene
Type and details of transgene
Is the transgene Plasmodium derived Transgene: not Plasmodium
Transgene nameGFP
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/constructPlasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid PvuI
Selectable marker used to select the mutant parasitepbdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modification1.2 kb of the 5’-UTR were amplified from gDNA and cloned into a standard transfection vector containing the GFP coding region with the non-regulatory regions of the P. berghei dihydrofolate synthase/folylpolyglutamate
synthase 3’UTR (PBANKA_134000). In addition this vector contains the pyrimethamine-resistant DHFR/TS cassette and two sequences for targeted homologous recombination by double crossover in an intergenic locus on P. berghei chromosome 12 (between PBANKA_122210 and PBANKA_122220)
Additional remarks selection procedure
Other details transgene
Promoter
Gene Model of Parasite PBANKA_1030100
Gene Model P. falciparum ortholog PF3D7_1412500
Gene productactin II
Gene product: Alternative nameactin2
Primer information details of the primers used for amplification of the promoter sequence  Click to view information
Primer information details of the primers used for amplification of the promoter sequence  Click to hide information
Sequence Primer 1AATCCTAGGTCTTTCTTCATATACATACCTTTCTTC
Additional information primer 15PbACT2-F; actin II 5'UTR
Sequence Primer 2TAAGGCGCCCATCTAAAAATAAACAATTGTGAACAC
Additional information primer 25PbACT2-R; actin II 5'UTR
3'-UTR
Gene Model of Parasite PBANKA_1340000
Gene productdihydrofolate synthase/folylpolyglutamate synthase, putative
Gene product: Alternative nameDHFS-FPGS
Primer information details of the primers used for amplification the 3'-UTR sequences  Click to view information
Primer information details of the primers used for amplification the 3'-UTR sequences  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
Insertion/Replacement locus
Replacement / InsertionInsertion locus
Gene Model of Parasite Not available
Gene productNot available
Gene product: Alternative name
Primer information details of the primers used for amplification of the target sequences  Click to view information
Primer information details of the primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
Sequence Primer 3
Additional information primer 3
Sequence Primer 4
Additional information primer 4