top of page |
Type and details of transgene |
Is the transgene Plasmodium derived |
Transgene: not Plasmodium |
Transgene name | GFP |
top of page |
Details of the genetic modification |
Inducable system used | No |
Additional remarks inducable system |
|
Type of plasmid/construct | Plasmid double cross-over |
PlasmoGEM (Sanger) construct/vector used | No |
Modified PlasmoGEM construct/vector used | No
|
Plasmid/construct map |
|
Plasmid/construct sequence |
|
Restriction sites to linearize plasmid |
PvuI
|
Selectable marker used to select the mutant parasite | pbdhfr |
Promoter of the selectable marker | pbdhfr |
Selection (positive) procedure | pyrimethamine |
Selection (negative) procedure | No |
Additional remarks genetic modification | 1.2 kb of the 5’-UTR were amplified from gDNA and cloned into a standard transfection vector containing the GFP coding region with the non-regulatory regions of the P. berghei dihydrofolate synthase/folylpolyglutamate
synthase 3’UTR (PBANKA_134000). In addition this vector contains the pyrimethamine-resistant DHFR/TS cassette and two sequences for targeted homologous recombination by double crossover in an intergenic locus on P. berghei chromosome 12 (between PBANKA_122210 and PBANKA_122220) |
Additional remarks selection procedure | |
top of page |
Other details transgene |
top of page |
Promoter |
Gene Model of Parasite |
PBANKA_1030100
|
Gene Model P. falciparum ortholog |
PF3D7_1412500
|
Gene product | actin II |
Gene product: Alternative name | actin2 |
Primer information details of the primers used for amplification of the promoter sequence 
Primer information details of the primers used for amplification of the promoter sequence
Sequence Primer 1 | AATCCTAGGTCTTTCTTCATATACATACCTTTCTTC |
Additional information primer 1 | 5PbACT2-F; actin II 5'UTR |
Sequence Primer 2 | TAAGGCGCCCATCTAAAAATAAACAATTGTGAACAC |
Additional information primer 2 | 5PbACT2-R; actin II 5'UTR |
|
|
top of page |
3'-UTR |
Gene Model of Parasite |
PBANKA_1340000
|
Gene product | dihydrofolate synthase/folylpolyglutamate synthase, putative |
Gene product: Alternative name | DHFS-FPGS |
Primer information details of the primers used for amplification the 3'-UTR sequences 
Primer information details of the primers used for amplification the 3'-UTR sequences
Sequence Primer 1 | |
Additional information primer 1 | |
Sequence Primer 2 | |
Additional information primer 2 | |
|
|
Insertion/Replacement locus |
Replacement / Insertion | Insertion locus |
Gene Model of Parasite |
Not available
|
Gene product | Not available |
Gene product: Alternative name | |
Primer information details of the primers used for amplification of the target sequences
Primer information details of the primers used for amplification of the target sequences
Sequence Primer 1 | |
Additional information primer 1 | |
Sequence Primer 2 | |
Additional information primer 2 | |
Sequence Primer 3 | |
Additional information primer 3 | |
Sequence Primer 4 | |
Additional information primer 4 | |
|
|
top of page |