RMgmDB - Rodent Malaria genetically modified Parasites

Summary

RMgm-631
Malaria parasiteP. berghei
Genotype
TaggedGene model (rodent): PBANKA_0816000; Gene model (P.falciparum): PF3D7_0915000; Gene product: type II NADH:ubiquinone oxidoreductase (NDH2)
Name tag: mCherry
Phenotype Asexual bloodstage; Gametocyte/Gamete; Fertilization and ookinete; Oocyst; Sporozoite; Liver stage;
Last modified: 25 August 2011, 22:27
  *RMgm-631
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene tagging
Reference (PubMed-PMID number) Reference 1 (PMID number) : 21771793
MR4 number
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone Not applicable
Other information parent line
The mutant parasite was generated by
Name PI/ResearcherK.E. Boysen; K. Matuschewski
Name Group/DepartmentParasitology Unit
Name InstituteMax Planck Institute for Infection Biology
CityBerlin
CountryGermany
Name of the mutant parasite
RMgm numberRMgm-631
Principal nameNDH2mCherry
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
Phenotype
Asexual blood stageLow mCherry-staining in asexual blood stages
Gametocyte/GameteGametocytes displayed intense punctuate or branched mCherry-staining
Fertilization and ookineteIn ookinetes, a prominent concentration of the staining signal in a branched structure adjacent to the parasite nucleus was detectable
OocystProminent mCherry-staining in oocysts
SporozoiteAbsence of mCherry-staining
Liver stageProminent mCherry-staining in late liver stages
Additional remarks phenotype

Mutant/mutation
The mutant expresses a C-terminally mCherry-tagged version of type II NADH:quinone oxidoreductase (NDH2).

Protein (function)
In Plasmodium parasites, NDH2 is one out of five mitochondrial dehydrogenases that feed electrons into the mitochondrial electron transport chain (mtETC). Typically, eukaryotes possess a multi-component rotenone-sensitive NADH:ubiquinone oxidoreductase, also termed complex I, which is located in the inner mitochondrial membrane. It catalyzes the transfer of electrons from NADH to ubiquinone (coenzyme Q, Q) leading to the reduced form, ubiquinol (QH2), and is involved in establishing the electro potential across the inner mitochondrial membrane (Δψm) by pumping hydrogen ions out of the mitochondrial matrix. Plasmodium spp., however, has a rotenone-insensitive, single subunit NADH:quinone oxidoreductase, also termed alternative complex I or NDH2. This enzyme is found in some bacteria and archea as well as in yeast and plants.
Phenotype analyses of a mutant lacking expression of NDH2 (see RMgm-630) indicate that NDH2 is not essential for asexual blood stages, gametocytes and ookinetes. NDH2 has an essential role during oocyst development and the formation of sporozoites.

Phenotype
Phenotype analyses of a mutant lacking expression of NDH2 (see RMgm-630) indicate that NDH2 is not essential for asexual blood stages, gametocytes and ookinetes. NDH2 has an essential role during oocyst development and the formation of sporozoites.

Phenotype analyses of the mutant expressing mCherry-tagged NDH2 by immuno-fluorescence using anti-mCherry antibodies showed low expression in asexual blood stages. Gametocytes displayed an intense punctuate or branched staining, indicative of abundant NDH2 protein that localizes to a cellular organelle, most likely the mitochondrion. In ookinetes, a prominent concentration of the signal in a branched structure adjacent to the parasite nucleus was detectable. NDH2 protein was prominent in oocysts and late liver stages, but absent in sporozoites. In gametocytes and ookinetes, the mCherry-signals showed overlap with signals of mitotracker, a mitochondrial-specific fluorescent dye.

Additional information

Other mutants
RMgm-630: A mutant lacking expression of NDH2 and expressing GFP under the control of the ndh2 promoter.


  Tagged: Mutant parasite with a tagged gene
Details of the target gene
Gene Model of Rodent Parasite PBANKA_0816000
Gene Model P. falciparum ortholog PF3D7_0915000
Gene producttype II NADH:ubiquinone oxidoreductase
Gene product: Alternative nameNDH2
Details of the genetic modification
Name of the tagmCherry
Details of taggingC-terminal
Additional remarks: tagging
Commercial source of tag-antibodies
Type of plasmid/constructPlasmid single cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid AflII
Selectable marker used to select the mutant parasitetgdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modificationA targeting vector was designed that contained a 5’ deleted copy of NDH2 fused to the mCherry protein. Upon single crossover by restriction endonuclease-mediated homologous recombination and positive selection with the antifolate pyrimethamine this vector is predicted to result in a functional, mCherry-tagged 5’ and a nonfunctional, promoter-less and amino-terminally deleted 3’ copy, separated by the positive selection marker.
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1ggagcggccgcaaattcttttaatataaaaggag
Additional information primer 1NDH2mCherry for (NotI)
Sequence Primer 2catgtcactagtgtagaatggcctacc
Additional information primer 2NDH2mCherry rev (SpeI)
Sequence Primer 3
Additional information primer 3
Sequence Primer 4
Additional information primer 4
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6