top of page |
Details of the target gene |
Gene Model of Rodent Parasite |
PBANKA_1212600
|
Gene Model P. falciparum ortholog |
PF3D7_1014200
|
Gene product | male gamete fusion factor HAP2, putative |
Gene product: Alternative name | HAP2; HAPLESS2; GCS1, generative cell specific 1 |
top of page |
Details of the genetic modification |
Short description of the mutation | The C-terminal region (downstream from the TM domain; amino acids 712-728) of hap2/gcs1 deleted |
Inducable system used | No |
Short description of the conditional mutagenesis | Not available |
Additional remarks inducable system |
|
Type of plasmid/construct | Plasmid double cross-over |
PlasmoGEM (Sanger) construct/vector used | No |
Modified PlasmoGEM construct/vector used | No
|
Plasmid/construct map |
|
Plasmid/construct sequence |
|
Restriction sites to linearize plasmid |
KpnI, XbaI
|
Selectable marker used to select the mutant parasite | tgdhfr |
Promoter of the selectable marker | pbdhfr |
Selection (positive) procedure | pyrimethamine |
Selection (negative) procedure | No |
Additional remarks genetic modification | For production of the –C construct, inverse PCR was employed to remove the entire C-terminal region (downstream from TM) from the PbGCS1 Full construct with the -CInvF/–CInvR primer set and the PbGCS1 Full construct as a template. The PCR product was treated with DpnI to digest the PbGCS1 Full template plasmid, and the 5’ end was phosphorylated and then self-ligated. The resultant construct was sequenced and cut. The endogenous hap2/gcs1 gene is replaced with the construct. |
Additional remarks selection procedure | |
Primer information: Primers used for amplification of the target sequences
Primer information: Primers used for amplification of the target sequences
Sequence Primer 1 | AGTAGATATAAAAAGGAAAAAGAAATTTAAAAAGAATGGTAGAAG |
Additional information primer 1 | -CInvR |
Sequence Primer 2 | TAAAATTACATGGAATAGTATTTGCAAATTTGTG |
Additional information primer 2 | -CInvF |
Sequence Primer 3 | |
Additional information primer 3 | |
Sequence Primer 4 | |
Additional information primer 4 | |
Sequence Primer 5 | |
Additional information primer 5 | |
Sequence Primer 6 | |
Additional information primer 6 | |
|
|
top of page |