RMgmDB - Rodent Malaria genetically modified Parasites

Summary

RMgm-606

Malaria parasite	P. berghei
Genotype
Mutated	Gene model (rodent): PBANKA_1212600; Gene model (P.falciparum): PF3D7_1014200; Gene product: male gamete fusion factor HAP2, putative (HAP2; HAPLESS2; GCS1, generative cell specific 1) Details mutation: The C-terminal region (downstream from the TM domain; amino acids 712-728) of hap2/gcs1 deleted
Phenotype	Fertilization and ookinete;

Last modified: 31 January 2011, 09:17

*RMgm-606

Successful modification	The parasite was generated by the genetic modification
The mutant contains the following genetic modification(s)	Gene mutation
Reference (PubMed-PMID number)	Reference 1 (PMID number) : 21209845
MR4 number
top of page
Parent parasite used to introduce the genetic modification
Rodent Malaria Parasite	P. berghei
Parent strain/line	P. berghei ANKA
Name parent line/clone	P. berghei ANKA 2.34
Other information parent line	P. berghei ANKA 2.34 is a cloned, gametocyte producer line of the ANKA strain (PubMed: PMID: 15137943).
top of page
The mutant parasite was generated by
Name PI/Researcher	M. Hirai
Name Group/Department	Department of Parasitology, Graduate School of Medicine
Name Institute	Gunma University
City	Gunma
Country	Japan
top of page
Name of the mutant parasite
RMgm number	RMgm-606
Principal name	-C KI
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modification	Yes
top of page
Phenotype
Asexual blood stage	Not different from wild type
Gametocyte/Gamete	Not different from wild type
Fertilization and ookinete	Normal ookinete production
Oocyst	Not tested
Sporozoite	Not tested
Liver stage	Not tested
Additional remarks phenotype	Mutant/mutation The mutant expresses a mutated form of HAP2/GCS1 lacking the entire C-terminal region downstream from the trans-membrane (TM) domain (amino acids 712-728). Protein (function) In Arabidopsis the male-specific sterility protein HAP2 has been identified by a genetic screen (HAP mutants: containing haploid-disrupting (hapless) mutations; Johnson M.A. et al., 2004, Genetics 168, 971-82) . A HAP2 family member called GCS1 (for generative cell-specific) was subsequently identified in a screen for lily genes whose transcripts were up-regulated in sperm (generative cells) . HAP2 is conserved and members were found in rice, Chlamydomonas, a red alga, a slime mold, Plasmodium falciparum, and Leishmania major. Phenotype analyses of Plasmodium mutants lacking expression of HAP2/GCS1 (RMgm-155, RMgm-156) indicate a role of HAP/GCS1 in fertilisation. Female gametes are fertile, whereas male gametes are sterile. Male gametes are able to attach to female gametes and form tight prefusion membrane attachments but the membranes of the gametes do not merge or fuse. As a result no zygotes/ookinetes are formed. Phenotype Ookinete production is comparable to ookinete production of wild type parasites, indicating that the the C-terminal region downstream from the trans-membrane (TM) domain is not essential for the function of HAP2/GCS1. Mutants lacking expression of HAP2/GCS1(RMgm-155, RMgm-156) show a defect in fertilisation and ookinete production. Additional information The phenotype has not been analyzed in detail. No information is provided on production of gametocytes and gametes, the process of fertilization or gamete fusion. The effect of the mutation has only been analyzed by quantification of ookinete production. A mutant has been generated in which the endogenous hap2/gsc1 gene was replaced by a wild type copy of hap2/gsc1 (mutant PbGCS1 Full KI). This mutant was used as a control to analyse the effect of the genetic modification of the locus on male fertility. The DNA construct used to generate the PbGCS1 Full KI line served as PCR template for preparing the DNA constructs used to generate the -HG (RMgm-605), -C and -TM/C (RMgm-607) mutant lines. Other mutants RMgm-155: An independent mutant lacking expression of HAP2/GCS1. RMgm-156: A mutant lacking expression of HAP2/GCS1. RMgm-157: A mutant expressing a GFP-tagged form of HAP2/GCS1 RMgm-167: A mutant expressing a GFP-tagged form of HAP2/GCS1 RMgm-158: A mutant expressing GFP under the control of the hap2/gcs1 promoter RMgm-605: A mutant expressing a mutated form of HAP2/GCS1 lacking the HAP2-GCS1 (HG) domain RMgm-607: A mutant expressing a mutated form of HAP2/GCS1 lacking the TM domain and the entire C-terminal region downstream from the TM

Mutated: Mutant parasite with a mutated gene

top of page

Details of the target gene

Gene Model of Rodent Parasite

PBANKA_1212600

Gene Model P. falciparum ortholog

PF3D7_1014200

Gene product

male gamete fusion factor HAP2, putative

Gene product: Alternative name

HAP2; HAPLESS2; GCS1, generative cell specific 1

top of page

Details of the genetic modification

Short description of the mutation

The C-terminal region (downstream from the TM domain; amino acids 712-728) of hap2/gcs1 deleted

Inducable system used

Short description of the conditional mutagenesis

Not available

Additional remarks inducable system

Type of plasmid/construct

Plasmid double cross-over

PlasmoGEM (Sanger) construct/vector used

Modified PlasmoGEM construct/vector used

Plasmid/construct map

Plasmid/construct sequence

Restriction sites to linearize plasmid

KpnI, XbaI

Selectable marker used to select the mutant parasite

tgdhfr

Promoter of the selectable marker

pbdhfr

Selection (positive) procedure

pyrimethamine

Selection (negative) procedure

Additional remarks genetic modification

For production of the –C construct, inverse PCR was employed to remove the entire C-terminal region (downstream from TM) from the PbGCS1 Full construct with the -CInvF/–CInvR primer set and the PbGCS1 Full construct as a template. The PCR product was treated with DpnI to digest the PbGCS1 Full template plasmid, and the 5’ end was phosphorylated and then self-ligated. The resultant construct was sequenced and cut. The endogenous hap2/gcs1 gene is replaced with the construct.

Additional remarks selection procedure

Primer information: Primers used for amplification of the target sequences Click to view information

Primer information: Primers used for amplification of the target sequences Click to hide information

Sequence Primer 1	AGTAGATATAAAAAGGAAAAAGAAATTTAAAAAGAATGGTAGAAG
Additional information primer 1	-CInvR
Sequence Primer 2	TAAAATTACATGGAATAGTATTTGCAAATTTGTG
Additional information primer 2	-CInvF
Sequence Primer 3
Additional information primer 3
Sequence Primer 4
Additional information primer 4
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6

top of page