top of page |
Type and details of transgene |
Is the transgene Plasmodium derived |
Transgene: not Plasmodium |
Transgene name | firefly luciferase |
top of page |
Details of the genetic modification |
Inducable system used | No |
Additional remarks inducable system |
|
Type of plasmid/construct | Plasmid single cross-over |
PlasmoGEM (Sanger) construct/vector used | No |
Modified PlasmoGEM construct/vector used | No
|
Plasmid/construct map |
|
Plasmid/construct sequence |
|
Restriction sites to linearize plasmid |
ApaI, SacII
|
Selectable marker used to select the mutant parasite | tgdhfr |
Promoter of the selectable marker | pbdhfr |
Selection (positive) procedure | pyrimethamine |
Selection (negative) procedure | No |
Additional remarks genetic modification | PBANKA_040200 (PB000869.01.0) was identified as being expressed at a low level in the liver relative to other stages. The upstream region of this gene was cloned in front of the FL resulting in the plasmid pFL869RLef1a (see also RMgm-594).
The plasmid used allows integration into the P. berghei d/c ssu rRNA locus, but is also able to persist in the parasite population as an episome. As both luciferases are encoded on the plasmid and therefore the genes are always present in equal numbers, it was not necessary to analyze genetically whether the parasite populations contained integrated or episomal gene copies or (as is most likely) a mixture of both. |
Additional remarks selection procedure | |
top of page |
Other details transgene |
top of page |
Promoter |
Gene Model of Parasite |
PBANKA_0402000
|
Gene Model P. falciparum ortholog |
PF3D7_0303400
|
Gene product | palmitoyltransferase DHHC1 |
Gene product: Alternative name | |
Primer information details of the primers used for amplification of the promoter sequence 
Primer information details of the primers used for amplification of the promoter sequence
Sequence Primer 1 | GGCCGCGGCCGCGTCTAAAGCATACAATAACTCTTAC |
Additional information primer 1 | Promoter region Forward (NotI) |
Sequence Primer 2 | CTAGCCTAGGTTTGTATATTTCTGAGATTCCAAAAAAA |
Additional information primer 2 | Promoter region Reverse (AvrII) |
|
|
top of page |
3'-UTR |
Gene Model of Parasite |
PBANKA_0719300
|
Gene product | bifunctional dihydrofolate reductase-thymidylate synthase, putative |
Gene product: Alternative name | dhfr/ts |
Primer information details of the primers used for amplification the 3'-UTR sequences 
Primer information details of the primers used for amplification the 3'-UTR sequences
Sequence Primer 1 | |
Additional information primer 1 | |
Sequence Primer 2 | |
Additional information primer 2 | |
|
|
Insertion/Replacement locus |
Replacement / Insertion | Insertion locus |
Gene Model of Parasite |
Not available
|
Gene product | Not available |
Gene product: Alternative name | small subunit ribosomal rna gene (c-type and/or d-type unit) |
Primer information details of the primers used for amplification of the target sequences
Primer information details of the primers used for amplification of the target sequences
Sequence Primer 1 | |
Additional information primer 1 | |
Sequence Primer 2 | |
Additional information primer 2 | |
Sequence Primer 3 | |
Additional information primer 3 | |
Sequence Primer 4 | |
Additional information primer 4 | |
|
|
top of page |