top of page |
Type and details of transgene |
Is the transgene Plasmodium derived |
Transgene: not Plasmodium |
Transgene name | GFP |
top of page |
Details of the genetic modification |
Inducable system used | No |
Additional remarks inducable system |
|
Type of plasmid/construct | Plasmid single cross-over |
PlasmoGEM (Sanger) construct/vector used | No |
Modified PlasmoGEM construct/vector used | No
|
Plasmid/construct map |
|
Plasmid/construct sequence |
|
Restriction sites to linearize plasmid |
ApaI, SacII
|
Selectable marker used to select the mutant parasite | tgdhfr |
Promoter of the selectable marker | pbdhfr |
Selection (positive) procedure | pyrimethamine |
Selection (negative) procedure | No |
Additional remarks genetic modification | Between the start codon of the PBANKA_100300 gene and the next gene upstream, a region of 989bp is present. This region, baring the promoter driving expression of PBANKA_100300, was used to replace the pbeef1aa promoter in plasmid pL0017 (MR4: MRA-786) to create plasmid pGFP103464.
The gfp gene and the 989bp PBANKA_100300 promoter region have been integrated into the genome by single cross-over integration. Therefore the possibility exists of reversion to the wild-type genotype by removal of the integrated DNA construct. In this mutant one or multiple copies of the gfp gene are integrated into the small subunit ribosomal rna gene (c-type or d-type unit). No gene model is yet available for this integration locus! |
Additional remarks selection procedure | |
top of page |
Other details transgene |
top of page |
Promoter |
Gene Model of Parasite |
PBANKA_1003000
|
Gene Model P. falciparum ortholog |
PF3D7_0405300
|
Gene product | liver specific protein 2, putative | sequestrin | 6-cysteine protein |
Gene product: Alternative name | LISP2 |
Primer information details of the primers used for amplification of the promoter sequence 
Primer information details of the primers used for amplification of the promoter sequence
Sequence Primer 1 | CGGATATCGTTGCATTATCGTCAAAAGTG |
Additional information primer 1 | Promoter region Forward (EcoRV) |
Sequence Primer 2 | CGGGATCCTTTTTATGTGTAAAAAAGTAAAATGATT |
Additional information primer 2 | Promoter region Reverse (BamHI) |
|
|
top of page |
3'-UTR |
Gene Model of Parasite |
PBANKA_0719300
|
Gene product | bifunctional dihydrofolate reductase-thymidylate synthase, putative |
Gene product: Alternative name | dhfr/ts |
Primer information details of the primers used for amplification the 3'-UTR sequences 
Primer information details of the primers used for amplification the 3'-UTR sequences
Sequence Primer 1 | |
Additional information primer 1 | |
Sequence Primer 2 | |
Additional information primer 2 | |
|
|
Insertion/Replacement locus |
Replacement / Insertion | Insertion locus |
Gene Model of Parasite |
Not available
|
Gene product | Not available |
Gene product: Alternative name | small subunit ribosomal rna gene (c-type and/or d-type unit) |
Primer information details of the primers used for amplification of the target sequences
Primer information details of the primers used for amplification of the target sequences
Sequence Primer 1 | |
Additional information primer 1 | |
Sequence Primer 2 | |
Additional information primer 2 | |
Sequence Primer 3 | |
Additional information primer 3 | |
Sequence Primer 4 | |
Additional information primer 4 | |
|
|
top of page |