RMgmDB - Rodent Malaria genetically modified Parasites

Summary

RMgm-589
Malaria parasiteP. berghei
Genotype
TaggedGene model (rodent): PBANKA_0917400; Gene model (P.falciparum): PF3D7_1130800; Gene product: armadillo repeat protein PF16, putative (PF16)
Name tag: GFP
Phenotype Gametocyte/Gamete; Fertilization and ookinete;
Last modified: 21 October 2010, 11:56
  *RMgm-589
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene tagging
Reference (PubMed-PMID number) Reference 1 (PMID number) : 20886115
MR4 number
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone P. berghei ANKA 2.34
Other information parent lineP. berghei ANKA 2.34 is a cloned, gametocyte producer line of the ANKA strain (PubMed: PMID: 15137943).
The mutant parasite was generated by
Name PI/ResearcherU. Straschil; R. Tewari
Name Group/DepartmentInstitute of Genetics, School of Biology
Name InstituteUniversity of Nottingham
CityNottingham
CountryUK
Name of the mutant parasite
RMgm numberRMgm-589
Principal namePbPF16-GFP
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
Phenotype
Asexual blood stageNot different from wild type
Gametocyte/GameteFaint, cytoplasmic, GFP expression in the male gametocytes. After induction of male gamete formation, GFP was associated with growing cytoplasmic axonemes (as detected by a-tubulin immunostaining). When male gametes were emerging from the residual body of the male gametocyte, PF16-GFP was localised to the emerging male gamete and had patchy distribution along the length of the gamete. The protein was not detected in female gametocytes and in activated female gametes or in the ookinete.
Fertilization and ookineteFaint, cytoplasmic, GFP expression in the male gametocytes. After induction of male gamete formation, GFP was associated with growing cytoplasmic axonemes (as detected by a-tubulin immunostaining). When male gametes were emerging from the residual body of the male gametocyte, PF16-GFP was localised to the emerging male gamete and had patchy distribution along the length of the gamete. The protein was not detected in female gametocytes and in activated female gametes or in the ookinete.
OocystNot tested
SporozoiteNot tested
Liver stageNot tested
Additional remarks phenotype

Mutant/mutation
The mutant expresses a GFP-tagged form (C-terminal) of PF16 (PBANKA_091740; PF11_0318)
Note that the PF16 gene is distinct from Pfs16, another gametocyte specific gene identified in P. falciparum (PFD0310w).

Protein (function)
All eukaryotic flagella contain an axoneme, a structure consisting of a central apparatus (a pair of microtubules named C1 and C2) encircled by nine doublet microtubules. PF16 is an important Armadillo (ARM)-repeat protein of the central apparatus of eukaryotic flagella. ARM-repeats consist of a ~42-amino acid structurally conserved repeating motif named after the Drosophila segment polarity gene Armadillo (mammalian homologue, b-catenin). Proteins containing ARM-repeats have diverse roles in eukaryotes, including cell signalling, cytoskeletal organisation and regulation of gene expression. Inactivation of the Chlamydomonas PF16 gene led to loss of the central pair of microtubules and abnormal flagellar function, showing that PF16 is required for flagellar motility and stability of the central apparatus C1 microtubule. Disruption of SPAG6, the mouse PF16 orthologue, results in male infertility, due to loss of sperm motility.RNAi of PF16 in the flagellated protozoan Trypanosoma brucei demonstrates a conserved role in flagellum-dependent motility.

Phenotype
The analyses indicate that PF16 is expressed in male gametocytes and male gametes.
See also RMgm-588 for a mutant lacking expression of PF16. Phenotype analyses of this mutant indicate that PF16 plays a crucial role maintaining the correct microtubule structure in the central apparatus of the axoneme of the male gamete . Mutant male gametes show abnormal flagellar movement and reduced fertility, but lack of PF16 expression does not lead to complete sterility.

Additional information
See also RMgm-588 for a mutant lacking expression of PF16. Phenotype analyses of this mutant indicate that PF16 plays a crucial role maintaining the correct microtubule structure in the central apparatus of the axoneme of the male gamete . Mutant male gametes show abnormal flagellar movement and reduced fertility, but lack of PF16 expression does not lead to complete sterility.

Other mutants
RMgm-588: a mutant lacking expression of PF16


  Tagged: Mutant parasite with a tagged gene
Details of the target gene
Gene Model of Rodent Parasite PBANKA_0917400
Gene Model P. falciparum ortholog PF3D7_1130800
Gene productarmadillo repeat protein PF16, putative
Gene product: Alternative namePF16
Details of the genetic modification
Name of the tagGFP
Details of taggingC-terminal
Additional remarks: tagging
Commercial source of tag-antibodies
Type of plasmid/constructPlasmid single cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid BglII
Selectable marker used to select the mutant parasitehdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modification
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1CCCCGGTACCGCATGCAACTGTTTATCACAAATAGC
Additional information primer 1T0021 (KpnI); C-terminus coding region Fw
Sequence Primer 2CCCCGGGCCCTTTTACTTGTAAATATTTTAAGCATCCTGAC
Additional information primer 2T0022 (ApaI); C-terminus coding region Rv
Sequence Primer 3
Additional information primer 3
Sequence Primer 4
Additional information primer 4
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6