RMgmDB - Rodent Malaria genetically modified Parasites

Summary

RMgm-580
Malaria parasiteP. berghei
Genotype
Genetic modification not successful
DisruptedGene model (rodent): PBANKA_1445600; Gene model (P.falciparum): PF3D7_1230900; Gene product: serine/threonine protein kinase RIO1, putative (rio1)
PhenotypeNo phenotype has been described
Last modified: 21 October 2010, 12:38
  *RMgm-580
Successful modificationThe gene/parasite could not be changed/generated by the genetic modification.
The following genetic modifications were attempted Gene disruption
Number of attempts to introduce the genetic modification 3
Reference (PubMed-PMID number) Reference 1 (PMID number) : 20951971
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone P. berghei ANKA 2.34
Other information parent lineP. berghei ANKA 2.34 is a cloned, gametocyte producer line of the ANKA strain (PubMed: PMID: 15137943).
Attempts to generate the mutant parasite were performed by
Name PI/ResearcherR. Tewari, O. Billker
Name Group/DepartmentWellcome Trust Sanger Institute
Name InstituteWellcome Trust Sanger Institute
CityCambridge Hinxton
CountryUK

  Disrupted: Mutant parasite with a disrupted gene
Details of the target gene
Gene Model of Rodent Parasite PBANKA_1445600
Gene Model P. falciparum ortholog PF3D7_1230900
Gene productserine/threonine protein kinase RIO1, putative
Gene product: Alternative namerio1
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct usedPlasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid
Partial or complete disruption of the genePartial
Additional remarks partial/complete disruption nearly complete
Selectable marker used to select the mutant parasitetgdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modificationThe gene has been targeted for gene deletion using a construct aimed at integration into the genome by double cross-over homologous recombination

The gene has been targeted for disruption in a 'kinome-wide' study for deletion of genes encoding Plasmodium protein kinases (protein kinase-like proteins).

See the paper for additional information
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1GGGGGGGCCCAATAATTACGTAGAAGGGCAACTCG
Additional information primer 1primer sequence target region 1a
Sequence Primer 2GGGGATCGATGGGAATAGAACAAAATCGCTATCC
Additional information primer 2primer sequence target region 1b
Sequence Primer 3GGGGGGATCCTATAAACCCTTTAGAAATGTTATACCTTG
Additional information primer 3primer sequence target region 2a
Sequence Primer 4GGGGCCGCGGTTTGCATATGTGACATACTTGTGTC
Additional information primer 4primer sequence target region 2b
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6