RMgmDB - Rodent Malaria genetically modified Parasites

Summary

RMgm-5399

Malaria parasite	P. berghei
Genotype
Tagged	Gene model (rodent): PBANKA_0522400; Gene model (P.falciparum): PF3D7_0422000; Gene product: steroid dehydrogenase, putative (Ketoacyl-CoA reductase, steroid dehydrogenase, KCR) Name tag: GFP
Phenotype	Fertilization and ookinete; Oocyst; Sporozoite;

Last modified: 5 March 2024, 18:43

*RMgm-5399

Successful modification	The parasite was generated by the genetic modification
The mutant contains the following genetic modification(s)	Gene tagging
Reference (PubMed-PMID number)	Reference 1 (PMID number) : 37543672
MR4 number
top of page
Parent parasite used to introduce the genetic modification
Rodent Malaria Parasite	P. berghei
Parent strain/line	P. berghei ANKA
Name parent line/clone	P. berghei ANKA 2.34
Other information parent line	P. berghei ANKA 2.34 is a cloned, gametocyte producer line of the ANKA strain (PubMed: PMID: 15137943).
top of page
The mutant parasite was generated by
Name PI/Researcher	Saeed S, Dessens JT
Name Group/Department	Department of Infection Biology, Faculty of Infectious and Tropical Diseases
Name Institute	London School of Hygiene & Tropical Medicine
City	London
Country	UK
top of page
Name of the mutant parasite
RMgm number	RMgm-5399
Principal name	KCR/GFP
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modification	Yes
top of page
Phenotype
Asexual blood stage	Not different from wild type
Gametocyte/Gamete	Not different from wild type
Fertilization and ookinete	KCR::GFP expressed in ookinetes
Oocyst	KCR::GFP expressed in oocysts. KCR::GFP-based fuorescence in budding sporozoites and in fully sporulated oocysts was notably weaker than in the oocyst sporoblast.Te localisation of KCR::GFP-based fuorescence was distinct from the putative apicoplast-specifc localisation of FabG, and instead displayed a more widespread subcellular distribution consistent with a localisation in ER membranes.
Sporozoite	KCR::GFP-based fuorescence in budding sporozoites and in fully sporulated oocysts was notably weaker than in the oocyst sporoblast.
Liver stage	Not tested
Additional remarks phenotype	Mutant/mutation The mutant expresses a C-terminal GFP-tagged version of KCR Protein (function) KCR (ketoacyl-CoA reductase) is an enzyme of involved in fatty acid elongation pathway Phenotype KCR::GFP expressed in oocysts. KCR::GFP-based fuorescence in budding sporozoites and in fully sporulated oocysts was notably weaker than in the oocyst sporoblast.Te localisation of KCR::GFP-based fuorescence was distinct from the putative apicoplast-specifc localisation of FabG, and instead displayed a more widespread subcellular distribution consistent with a localisation in ER membranes. Additional information Other mutants

Tagged: Mutant parasite with a tagged gene

top of page

Details of the target gene

Gene Model of Rodent Parasite

PBANKA_0522400

Gene Model P. falciparum ortholog

PF3D7_0422000

Gene product

steroid dehydrogenase, putative

Gene product: Alternative name

Ketoacyl-CoA reductase, steroid dehydrogenase, KCR

top of page

Details of the genetic modification

Name of the tag

GFP

Details of tagging

C-terminal

Additional remarks: tagging

Commercial source of tag-antibodies

Type of plasmid/construct

(Linear) plasmid single cross-over

PlasmoGEM (Sanger) construct/vector used

Modified PlasmoGEM construct/vector used

Plasmid/construct map

Plasmid/construct sequence

Restriction sites to linearize plasmid

Selectable marker used to select the mutant parasite

hdhfr

Promoter of the selectable marker

eef1a

Selection (positive) procedure

pyrimethamine

Selection (negative) procedure

Additional remarks genetic modification

To generate a parasite line expressing KCR fused to GFP (KCR/GFP), the coding sequence of PBANKA_0522400 plus approximately 0.45 kb of the 5′UTR was PCR amplified with primers pDNR-05524-F (ACGAAGTTATCAGTCGAGGTACCTGATTCAACTATATTACCGCAGATAC) and pDNR-05524-R (ATGAGGGCCCCTAAGCTTTCTTCTTTCTTCATTTTTTTCAAC) and introduced into SalI/HindIII-digested pDNR-EGFP via In-Fusion cloning to give plasmid pDNR-KCR/EGFP. An approximately 0.77 kb sequence corresponding to the 3′UTR of PBANKA_005524 was PCR amplified with primers pLP-05224-F (ATATGCTAGAGCGGCCAGTGTGCTCACTTTTTGTTATTTTG) and pLP-05224-R (CACCGCGGTGGCGGCCTTTGGAAAATATGCAAAGC) and introduced into NotI-digested pLP-hDHFR via In-Fusion cloning to give plasmid pLP-hDHFR/KCR. The kcr-specific sequence from pDNR-KCR/EGFP was introduced into pLP-hDHFR/KCR via Cre-loxP site-specific recombination to give the final construct pLP-KCR/EGFP. This plasmid was linearised with KpnI and SacII and transfected into purified schizonts for integration into the kcr locus by double crossover homologous recombination

Additional remarks selection procedure

Primer information: Primers used for amplification of the target sequences Click to view information

Primer information: Primers used for amplification of the target sequences Click to hide information

Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
Sequence Primer 3
Additional information primer 3
Sequence Primer 4
Additional information primer 4
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6

top of page