SummaryRMgm-5360
|
||||||||
*RMgm-5360| Successful modification | The parasite was generated by the genetic modification |
| The mutant contains the following genetic modification(s) | Gene mutation |
| Reference (PubMed-PMID number) |
Reference 1 (PMID number) : 36979393 |
| MR4 number | |
| top of page | |
| Parent parasite used to introduce the genetic modification | |
| Rodent Malaria Parasite | P. yoelii |
| Parent strain/line | P. yoelii 17XL |
| Name parent line/clone | Not applicable |
| Other information parent line | 17XL is a lethal strain of P. yoelii |
| top of page | |
| The mutant parasite was generated by | |
| Name PI/Researcher | Otsuki H,Torii M |
| Name Group/Department | Division of Molecular Parasitology, Proteo-Science Center |
| Name Institute | Ehime University Graduate School of Medicine |
| City | Toon, Ehime |
| Country | Japan |
| top of page | |
| Name of the mutant parasite | |
| RMgm number | RMgm-5360 |
| Principal name | 17XL - seven different mutants with mutated Cys residues in EBL region 6 |
| Alternative name | |
| Standardized name | |
| Is the mutant parasite cloned after genetic modification | Yes |
| top of page | |
| Phenotype | |
| Asexual blood stage | See below for the phenotype of growth, multiplication, virulence, erythrocyte/reticulocyte invasion of asexual blood stages and EBL localization. |
| Gametocyte/Gamete | Not tested |
| Fertilization and ookinete | Not tested |
| Oocyst | Not tested |
| Sporozoite | Not tested |
| Liver stage | Not tested |
| Additional remarks phenotype | Mutant/mutation The 7 mutants are: Protein (function) The 7 mutants are: Infection with the parental 17X strain did not kill any mice, whereas the lethal 17XL strain parasite killed all the infected mice by day 9. To investigate whether the altered infection courses observed in the transgenic lines were caused by a difference of erythrocyte preference in the invasion process, a selectivity index (SI) was calculated by multiple parasite infections of single erythrocytes for each parasite line on day 4 post infection. A higher SI value indicates that the parasites invaded into a limited population of erythrocytes, and lower SI means that the parasites invaded into a broader population of erythrocytes. In our previous study, the parasite infectivity and erythrocyte preference of P. yoelii 17X lineages were related to the localization of PyEBL; specifically, the 17X-type showed microneme localization whereas the 17XL-type showed dense granule localization. |
Mutated: Mutant parasite with a mutated gene| top of page | |||||||||||||||||||||||||||
| Details of the target gene | |||||||||||||||||||||||||||
| Gene Model of Rodent Parasite | PY17X_1337400 | ||||||||||||||||||||||||||
| Gene Model P. falciparum ortholog | PF3D7_1301600 | ||||||||||||||||||||||||||
| Gene product | erythrocyte binding antigen-140 | ||||||||||||||||||||||||||
| Gene product: Alternative name | EBL; PyEBL | ||||||||||||||||||||||||||
| top of page | |||||||||||||||||||||||||||
| Details of the genetic modification | |||||||||||||||||||||||||||
| Short description of the mutation | Seven different mutants with mutated Cys residues in EBL region 6 | ||||||||||||||||||||||||||
| Inducable system used | No | ||||||||||||||||||||||||||
| Short description of the conditional mutagenesis | Not available | ||||||||||||||||||||||||||
| Additional remarks inducable system | |||||||||||||||||||||||||||
| Type of plasmid/construct | (Linear) plasmid double cross-over | ||||||||||||||||||||||||||
| PlasmoGEM (Sanger) construct/vector used | No | ||||||||||||||||||||||||||
| Modified PlasmoGEM construct/vector used | No | ||||||||||||||||||||||||||
| Plasmid/construct map | |||||||||||||||||||||||||||
| Plasmid/construct sequence | |||||||||||||||||||||||||||
| Restriction sites to linearize plasmid | XhoI | ||||||||||||||||||||||||||
| Selectable marker used to select the mutant parasite | hdhfr | ||||||||||||||||||||||||||
| Promoter of the selectable marker | pbdhfr | ||||||||||||||||||||||||||
| Selection (positive) procedure | pyrimethamine | ||||||||||||||||||||||||||
| Selection (negative) procedure | No | ||||||||||||||||||||||||||
| Additional remarks genetic modification | The previously described plasmids pPbDT3U-B12 and pHDEF1-mh-R12 were modified and used. Briefly, the GFPm2 sequence was amplified using KOD Plus DNA polymerase (TOYOBO, Japan) with primers P1 (5' ggatccAGTAAAGGAGAAGAACTTTTCAC 3') and P2 (5' gtcgac- CTATTTGTATAGTTCATCCATGC 3') at an annealing temperature of 49 C for 40 cycles; from a pHDEF1-mh-based plasmid containing GFPm2 derived from a plasmid pHRPGFPm2 and ligated into the pGEM-T Easy plasmid (Promega, Madison, WI, USA). The insert was then digested with BamHI and SalI, purified, and ligated into pPbDT3U-B12 to produce pGFP-DT3U-B12. Fragments containing PyEBL region 2 to the cytoplasmic tail (Cyt) and PyEBL 3' UTR were amplified using primers P3 (5' gagactcgagTCTTCTGTTAAACCCAGTAATAC 3') and P4 (5' tctagaATAAAAATCTACAGGTATATATTC 3') at an annealing temperature of 60 C for 40 cycles, and P5 (5' ccatggCAAAATATTGAATTGAAGCC 3') and P6 (5' ctcgagCATGTAATAAATAAATTAATA 3') at an annealing temperature of 55 C for 40 cycles. Amplified fragments were subcloned, and the sequences were confirmed. The subcloned fragments and pGFP-DT3U-B12 plasmid were then digested and ligated using T4 DNA ligase to produce donor vector pGFPDTPyEBLR6mod. The donor vector was mixed with pDONR221 and BP clonase (Invitrogen, Carlsbad, CA, USA), and the reaction was carried out to generate the entry vector pENTRYPyEBLR6mod. To insert nucleotide mutations conferring single amino acid substitutions into the entry vector, the QuikChange® II Site-Directed Mutagenesis Kit (Stratagene, La Jolla, CA, USA) or PrimeStar® Mutagenesis Basal Kit (TAKARA, Otsu, Japan) and specific primers were used for substitution. All of the mutated entry vectors were validated by sequencing. The PyEBL region 6 mutated entry vector was mixed with pHDEF1-mh-R12 destination vector as described, and an LR reaction was performed to generate the pYEBL-PyEBLR6mod-GFP constructs. For transfection the constructs were linearized by digestion with XhoI. For localization analysis a GFP tag was fused at the C-terminus of the EBL protein. | ||||||||||||||||||||||||||
| Additional remarks selection procedure | |||||||||||||||||||||||||||
| |||||||||||||||||||||||||||
| top of page | |||||||||||||||||||||||||||