SummaryRMgm-4869
|
Successful modification | The parasite was generated by the genetic modification |
The mutant contains the following genetic modification(s) | Gene mutation, Introduction of a transgene |
Reference (PubMed-PMID number) |
Reference 1 (PMID number) : 32866196 |
MR4 number | |
top of page | |
Parent parasite used to introduce the genetic modification | |
Rodent Malaria Parasite | P. berghei |
Parent strain/line | P. berghei ANKA |
Name parent line/clone | RMgm-1305 |
Other information parent line | The mutant (pG204) expresses (myc-tagged) Os-TIR1 protein. The ostir1 gene is under control of the strong and constitutive hsp70 promoter and the 3'UTR of p28. The transgene is integrated into the silent 230p locus. The mutant does not express a drug-selectable marker. This mutant ('transgenic acceptor lines') is used to specifically and rapidly and selectively degrade Plasmodium proteins that have been tagged with an auxin-inducible degron (AID). This requires tagging genes of interest (GOI) in the Os-TIR1-expressing mutants with the aid sequence. Subsequently, these parasites expressing both Os-TIR1 and a AID-tagged GOI need to be treated with auxin for degradation of the AID-tagged protein. |
top of page | |
The mutant parasite was generated by | |
Name PI/Researcher | Govindasamy K, Bhanot P |
Name Group/Department | Department of Microbiology, Biochemistry and Molecular Genetics |
Name Institute | Rutgers New Jersey Medical School |
City | New Jersey |
Country | USA |
top of page | |
Name of the mutant parasite | |
RMgm number | RMgm-4869 |
Principal name | CDPK5-aid-HA |
Alternative name | |
Standardized name | |
Is the mutant parasite cloned after genetic modification | Yes |
top of page | |
Phenotype | |
Asexual blood stage | Not tested |
Gametocyte/Gamete | Not tested |
Fertilization and ookinete | Not tested |
Oocyst | Not different from wild type |
Sporozoite | Normal numbers of sporozoites. Auxin treated CDPK5-aid-HA sporozoites show reduced motility. Auxin treated CDPK5-aid-HA sporozoites show reduced invasion of hepatocytes (50%) |
Liver stage | Auxin treated CDPK5-aid-HA sporozoites show reduced invasion of hepatocytes (50%) Auxin treatment of CDPK5-aid-HA infected hepatocytes results in reduced egress from hepatocytes and from merosomes |
Additional remarks phenotype | Mutant/mutation Phenotype Evidence is presented that: Additional information |
top of page | |||||||||||||||||||||||||||
Details of the target gene | |||||||||||||||||||||||||||
Gene Model of Rodent Parasite | PBANKA_1351500 | ||||||||||||||||||||||||||
Gene Model P. falciparum ortholog | PF3D7_1337800 | ||||||||||||||||||||||||||
Gene product | calcium-dependent protein kinase 5 | ||||||||||||||||||||||||||
Gene product: Alternative name | CDPK5 | ||||||||||||||||||||||||||
top of page | |||||||||||||||||||||||||||
Details of the genetic modification | |||||||||||||||||||||||||||
Short description of the mutation | C-terminal tagging of CDPK5 with the AID-2xHA degron | ||||||||||||||||||||||||||
Inducable system used | No | ||||||||||||||||||||||||||
Short description of the conditional mutagenesis | Not available | ||||||||||||||||||||||||||
Additional remarks inducable system | |||||||||||||||||||||||||||
Type of plasmid/construct | (Linear) plasmid single cross-over | ||||||||||||||||||||||||||
PlasmoGEM (Sanger) construct/vector used | No | ||||||||||||||||||||||||||
Modified PlasmoGEM construct/vector used | No | ||||||||||||||||||||||||||
Plasmid/construct map | |||||||||||||||||||||||||||
Plasmid/construct sequence | |||||||||||||||||||||||||||
Restriction sites to linearize plasmid | |||||||||||||||||||||||||||
Selectable marker used to select the mutant parasite | hdhfr | ||||||||||||||||||||||||||
Promoter of the selectable marker | eef1a | ||||||||||||||||||||||||||
Selection (positive) procedure | pyrimethamine | ||||||||||||||||||||||||||
Selection (negative) procedure | No | ||||||||||||||||||||||||||
Additional remarks genetic modification | The targeting plasmid for modifying CDPK4 with the aid-HA degron was constructed by amplifying a C-terminal fragment of CDPK4 using PCR primers AATTGGAGCTCCACCGCGGCAAGTATTAAGTGGTATTACATATATG and TCATTCTAGTCTCGAGATAGTTACATAGTTTTATTAACATGTCTC. The PCR product was cloned into the previously described AID-tagging plasmid expressing mCherry (pG364), using SacII and XhoI. The targeting plasmid for modifying CDPK5 with the aid-HA degron was constructed by cloning a fragment amplified using PCR primers AATTGGAGCT-CCACCGCGGCATAGAGATTTAAAGCCAGAA and TCATTCTAGTCTCGAGAGATTGT-CTTCCAGACATC, into a previously described AID-tagging plasmid expressing GFP (pG362). The CDPK4-aid-HA targeting plasmid was linearized using BspEI and the CDPK5-aid-HA targeting plasmid was linearized using BclI. Linearized plasmids were transfected into the previously described OsTIR1-expressing parent line | ||||||||||||||||||||||||||
Additional remarks selection procedure | |||||||||||||||||||||||||||
| |||||||||||||||||||||||||||
top of page |
top of page | |||||||||||||||||||
Type and details of transgene | |||||||||||||||||||
Is the transgene Plasmodium derived | Transgene: not Plasmodium | ||||||||||||||||||
Transgene name | (myc-tagged) Os-TIR1 protein | ||||||||||||||||||
top of page | |||||||||||||||||||
Details of the genetic modification | |||||||||||||||||||
Inducable system used | No | ||||||||||||||||||
Additional remarks inducable system | |||||||||||||||||||
Type of plasmid/construct | (Linear) plasmid double cross-over | ||||||||||||||||||
PlasmoGEM (Sanger) construct/vector used | No | ||||||||||||||||||
Modified PlasmoGEM construct/vector used | No | ||||||||||||||||||
Plasmid/construct map | |||||||||||||||||||
Plasmid/construct sequence | |||||||||||||||||||
Restriction sites to linearize plasmid | |||||||||||||||||||
Selectable marker used to select the mutant parasite | No selectable marker | ||||||||||||||||||
Promoter of the selectable marker | N.A. | ||||||||||||||||||
Selection (positive) procedure | N.A. | ||||||||||||||||||
Selection (negative) procedure | N.A. | ||||||||||||||||||
Additional remarks genetic modification | The plasmid (pG230) used to generate the OsTIR1 expressing parent line pG230 (in P. berghei ANKA HP background; see RMgm-1304) was derived from the pG0148 vector (Sinha et al., 2014). The cfp gene in pG0148 was replaced by ostir1-9myc [amplified from BYP6743 plasmid (Yeast Genetic Resource Center, Osaka, Japan) with primer pair GU2102/GU2063] using the XhoI and SmaI restriction sites between the hsp70 (PBANKA_071190) promoter and p45/48 3′ UTR. The pG230 plasmid contains target regions for double crossover integration into the locus for the non-essential gene p230p and also a negative selection cassette to generate a marker-free line. To generate the pG204 construct the p45/48 3′ UTR was replaced by the p28 3′ UTR | ||||||||||||||||||
Additional remarks selection procedure | The selectable marker cassette hdhfr-yfcu used to integrate the construct into the 230p locus with positive selection (pyrimethamine) has been removed by negative selection (5-FC) | ||||||||||||||||||
top of page | |||||||||||||||||||
Other details transgene | |||||||||||||||||||
top of page | |||||||||||||||||||
Promoter | |||||||||||||||||||
Gene Model of Parasite | PBANKA_0711900 | ||||||||||||||||||
Gene Model P. falciparum ortholog | PF3D7_0818900 | ||||||||||||||||||
Gene product | heat shock protein 70 | ||||||||||||||||||
Gene product: Alternative name | HSP70 | ||||||||||||||||||
| |||||||||||||||||||
top of page | |||||||||||||||||||
3'-UTR | |||||||||||||||||||
Gene Model of Parasite | PBANKA_0514900 | ||||||||||||||||||
Gene product | 28 kDa ookinete surface protein | ||||||||||||||||||
Gene product: Alternative name | P28 | ||||||||||||||||||
| |||||||||||||||||||
Insertion/Replacement locus | |||||||||||||||||||
Replacement / Insertion | Replacement locus | ||||||||||||||||||
Gene Model of Parasite | PBANKA_0306000 | ||||||||||||||||||
Gene product | 6-cysteine protein | ||||||||||||||||||
Gene product: Alternative name | 230p | ||||||||||||||||||
| |||||||||||||||||||
top of page |