SummaryRMgm-4861
|
Successful modification | The parasite was generated by the genetic modification |
The mutant contains the following genetic modification(s) | Gene tagging |
Reference (PubMed-PMID number) |
Reference 1 (PMID number) : 32736136 |
MR4 number | |
top of page | |
Parent parasite used to introduce the genetic modification | |
Rodent Malaria Parasite | P. berghei |
Parent strain/line | P. berghei ANKA |
Name parent line/clone | P. berghei ANKA 2.34 |
Other information parent line | P. berghei ANKA 2.34 is a cloned, gametocyte producer line of the ANKA strain (PubMed: PMID: 15137943). |
top of page | |
The mutant parasite was generated by | |
Name PI/Researcher | Tremp AZ, Dessens JT |
Name Group/Department | Department of Infection Biology, Faculty of Infectious and Tropical Diseases |
Name Institute | London School of Hygiene & Tropical Medicine |
City | London |
Country | UK |
top of page | |
Name of the mutant parasite | |
RMgm number | RMgm-4861 |
Principal name | PHL3-GFP |
Alternative name | |
Standardized name | |
Is the mutant parasite cloned after genetic modification | Yes |
top of page | |
Phenotype | |
Asexual blood stage | Not tested |
Gametocyte/Gamete | Not tested |
Fertilization and ookinete | PHL3-GFP located in the crystalloid of ookinetes |
Oocyst | Not tested |
Sporozoite | Not tested |
Liver stage | Not tested |
Additional remarks phenotype | Mutant/mutation |
top of page | |||||||||||||||||||||||||||
Details of the target gene | |||||||||||||||||||||||||||
Gene Model of Rodent Parasite | PBANKA_0704900 | ||||||||||||||||||||||||||
Gene Model P. falciparum ortholog | PF3D7_0825700 | ||||||||||||||||||||||||||
Gene product | crystalloid-specific PH domain-containing protein, putative | ||||||||||||||||||||||||||
Gene product: Alternative name | CryPH, PH-like (PHL) domain-containing protein; PHL3 | ||||||||||||||||||||||||||
top of page | |||||||||||||||||||||||||||
Details of the genetic modification | |||||||||||||||||||||||||||
Name of the tag | GFP | ||||||||||||||||||||||||||
Details of tagging | C-terminal | ||||||||||||||||||||||||||
Additional remarks: tagging | |||||||||||||||||||||||||||
Commercial source of tag-antibodies | |||||||||||||||||||||||||||
Type of plasmid/construct | (Linear) plasmid single cross-over | ||||||||||||||||||||||||||
PlasmoGEM (Sanger) construct/vector used | No | ||||||||||||||||||||||||||
Modified PlasmoGEM construct/vector used | No | ||||||||||||||||||||||||||
Plasmid/construct map | |||||||||||||||||||||||||||
Plasmid/construct sequence | |||||||||||||||||||||||||||
Restriction sites to linearize plasmid | |||||||||||||||||||||||||||
Selectable marker used to select the mutant parasite | hdhfr | ||||||||||||||||||||||||||
Promoter of the selectable marker | eef1a | ||||||||||||||||||||||||||
Selection (positive) procedure | pyrimethamine | ||||||||||||||||||||||||||
Selection (negative) procedure | No | ||||||||||||||||||||||||||
Additional remarks genetic modification | An approximately 1.5 kb fragment corresponding to the coding sequence and 5’UTR of PBANKA_0417200 was PCR amplified from P. berghei genomic DNA with primers PH1-F (TTGGGCTGCAGTCGAGGTACCACAAAACAATTGTCATAAAATAGTTCTTG) and PH1-R (ATGAGGGCCCCTAAGCTCATATCGTTATCGTTTTCTTCATTG) and cloned into SalI/HindIII-digested plasmid pBS-EGFP-hDHFR to give pBS-PH1/GFP. The plasmid was linearized with HindIII before gene targeting by single crossover homologous recombination. An approximately 1.8 kb fragment corresponding to the coding sequence and 5’UTR of PBANKA_0704800 was PCR amplified from P. berghei genomic DNA with primers PH2-F (TTGGGCTGCAGTCGAGGTACCATGCGCATTTATAATATACATAAATAAG) and PH2-R (ATGAGGGCCCCTAAGCTCAAATTATCATCATCATTATCTTCATATTCTTC) and cloned into SalI/HindIII-digested plasmid pBS-EGFP-hDHFR to give pBS-PH2/GFP. The plasmid was linearized with ClaI before gene targeting by single crossover homologous recombination. An approximately 2.0 kb fragment corresponding to the coding sequence and 5’UTR of PBANKA_0704900 was PCR amplified from P. berghei genomic DNA with primers PH3-F (TTGGGCTGCAGTCGAGGTACCATTTCTTATTAATAGACAAAACAAAAATAAT) and PH3-R (ATGAGGGCCCCTAAGCTCTTAAGAGAAATATTTGGATTACTGCTTTT) and cloned into SalI/HindIII-digested plasmid pBS-EGFP-hDHFR to give pBS-PH3/GFP. The plasmid was linearized with NheI before gene targeting by single crossover homologous recombination. An approximately 1.8 kb fragment corresponding to the coding sequence and 5’UTR of PBANKA_0902900 was PCR amplified from P. berghei genomic DNA with primers PH4-F (TTGGGCTGCAGTCGAGGTACCTTTGTACATACATTCAAAAGGCG) and PH4-R (ATGAGGGCCCCTAAGCTGGTCTCTGCTTTTATGGAAACTAAAAAA) and cloned into SalI/HindIII-digested plasmid pBS-EGFP-hDHFR to give pBS-PH4/GFP. The plasmid was linearized with ClaI before gene targeting by single crossover homologous recombination. | ||||||||||||||||||||||||||
Additional remarks selection procedure | |||||||||||||||||||||||||||
| |||||||||||||||||||||||||||
top of page |