| top of page |
| Details of the target gene |
| Gene Model of Rodent Parasite |
PBANKA_1449300
|
| Gene Model P. falciparum ortholog |
PF3D7_1234700
|
| Gene product | upregulated in late gametocytes ULG8 |
| Gene product: Alternative name | CPW-WPC family protein; CPW2 |
| top of page |
| Details of the genetic modification |
| Name of the tag | GFP |
| Details of tagging | C-terminal |
| Additional remarks: tagging | |
| Commercial source of tag-antibodies | |
| Type of plasmid/construct | (Linear) plasmid single cross-over |
| PlasmoGEM (Sanger) construct/vector used | No |
| Modified PlasmoGEM construct/vector used | No
|
| Plasmid/construct map |
|
| Plasmid/construct sequence |
|
| Restriction sites to linearize plasmid |
|
| Selectable marker used to select the mutant parasite | hdhfr |
| Promoter of the selectable marker | eef1a |
| Selection (positive) procedure | pyrimethamine |
| Selection (negative) procedure | No |
| Additional remarks genetic modification | An approximately 2.2 kb fragment corresponding to the coding sequence and 5’UTR of PBANKA_0943400 was PCR amplified from P. berghei genomic DNA with primers CPW1-F (TTGGGCTGCAGTCGAGCAAGGGACTGTAATGGTGA) and CPW1-R (ATGAGGGCCCCTAAGCTCTCTAAGGTGATCCCTTTTTTGTTTG) and cloned into SalI/HindIII digested plasmid pBS-EGFP-hDHFR to give pBS-CPW1/GFP. The plasmid was linearized with HindIII before gene targeting by single crossover homologous recombination.
An approximately 1.4 kb fragment corresponding to the coding sequence and 5’UTR of PBANKA_1449300 was PCR amplified from P. berghei genomic DNA with primers CPW2-F (TTGGGCTGCAGTCGAGATAACAATTGAACTTGGTAAAGTAGCA) and CPW2-R (ATGAGGGCCCCTAAGCTCAATTTTTGAACTTGTATAAAAGAATAATTAATTT) and cloned into SalI/HindIII-digested plasmid pBS-EGFP-hDHFR to give pBS-CPW2/GFP. The plasmid was linearized with HindIII before gene targeting by single crossover homologous recombination.
An approximately 2.4 kb fragment corresponding to the coding sequence and 5’UTR of PBANKA_1218300 was PCR amplified from P. berghei genomic DNA with primers CPW3-F (TTGGGCTGCAGTCGAGCAATATGGGATTGCGATTTG) and CPW3-R (ATGAGGGCCCCTAAGCTCACATCGATTATTGCCCCTG) and cloned into SalI/HindIII-digested plasmid pBS-EGFP-hDHFR to give pBS-CPW3/GFP. The plasmid was linearized with BlpI before gene targeting by single crossover homologous recombination. An approximately 1.5 kb fragment corresponding to the coding sequence and 5’UTR of PBANKA_1015400 was PCR amplified from P. berghei genomic DNA with primers CPW4-F2 (TTGGGCTGCAGTCGAGACAATTTTTTATTGTTAAAATAGATAATGG) and CPW4-R (ATGAGGGCCCCTAAGCTGATAACAAGGTTTGAAACTATTTCCCC) and cloned into SalI/HindIII-digested plasmid pBS-EGFP-hDHFR to give pBS-CPW4/GFP. The plasmid was linearized with ClaI before gene targeting by single crossover homologous recombination. |
| Additional remarks selection procedure | |
Primer information: Primers used for amplification of the target sequences
Primer information: Primers used for amplification of the target sequences
| Sequence Primer 1 | |
| Additional information primer 1 | |
| Sequence Primer 2 | |
| Additional information primer 2 | |
| Sequence Primer 3 | |
| Additional information primer 3 | |
| Sequence Primer 4 | |
| Additional information primer 4 | |
| Sequence Primer 5 | |
| Additional information primer 5 | |
| Sequence Primer 6 | |
| Additional information primer 6 | |
|
|
| top of page |