SummaryRMgm-480
|
Successful modification | The parasite was generated by the genetic modification | ||||||||||||||||||||||||
The mutant contains the following genetic modification(s) | Gene disruption | ||||||||||||||||||||||||
Reference (PubMed-PMID number) |
Reference 1 (PMID number) : 21418605 | ||||||||||||||||||||||||
MR4 number | |||||||||||||||||||||||||
top of page | |||||||||||||||||||||||||
Parent parasite used to introduce the genetic modification | |||||||||||||||||||||||||
Rodent Malaria Parasite | P. berghei | ||||||||||||||||||||||||
Parent strain/line | P. berghei ANKA | ||||||||||||||||||||||||
Name parent line/clone | P. berghei ANKA cl15cy1 | ||||||||||||||||||||||||
Other information parent line | A reference wild type clone from the ANKA strain of P. berghei (PubMed: PMID: 17406255). | ||||||||||||||||||||||||
top of page | |||||||||||||||||||||||||
The mutant parasite was generated by | |||||||||||||||||||||||||
Name PI/Researcher | J. Fonager; S.M. Khan; C.J. Janse | ||||||||||||||||||||||||
Name Group/Department | Leiden Malaria Research Group | ||||||||||||||||||||||||
Name Institute | Leiden University Medical Center | ||||||||||||||||||||||||
City | Leiden | ||||||||||||||||||||||||
Country | The Netherlands | ||||||||||||||||||||||||
top of page | |||||||||||||||||||||||||
Name of the mutant parasite | |||||||||||||||||||||||||
RMgm number | RMgm-480 | ||||||||||||||||||||||||
Principal name | 318cl1, 318cl2 | ||||||||||||||||||||||||
Alternative name | Δp41 | ||||||||||||||||||||||||
Standardized name | |||||||||||||||||||||||||
Is the mutant parasite cloned after genetic modification | Yes | ||||||||||||||||||||||||
top of page | |||||||||||||||||||||||||
Phenotype | |||||||||||||||||||||||||
Asexual blood stage | The phenotype of blood stages has not been analysed in detail. During the cloning procedure no evidence has been found for a delayed/affected growth/multiplication of the asexual blood stages. The generation of mutants lacking expression of P41 indicates that P41 is not essential for asexual blood stage development. | ||||||||||||||||||||||||
Gametocyte/Gamete | Not tested | ||||||||||||||||||||||||
Fertilization and ookinete | Not tested | ||||||||||||||||||||||||
Oocyst | Not tested | ||||||||||||||||||||||||
Sporozoite | Not tested | ||||||||||||||||||||||||
Liver stage | Not tested | ||||||||||||||||||||||||
Additional remarks phenotype | Mutant/mutation Table: P. falciparum gene members of the 6-cys family
|
top of page | |||||||||||||||||||||||||
Details of the target gene | |||||||||||||||||||||||||
Gene Model of Rodent Parasite | PBANKA_1002600 | ||||||||||||||||||||||||
Gene Model P. falciparum ortholog | PF3D7_0404900 | ||||||||||||||||||||||||
Gene product | 6-cysteine protein | ||||||||||||||||||||||||
Gene product: Alternative name | P41 | ||||||||||||||||||||||||
top of page | |||||||||||||||||||||||||
Details of the genetic modification | |||||||||||||||||||||||||
Inducable system used | No | ||||||||||||||||||||||||
Additional remarks inducable system | |||||||||||||||||||||||||
Type of plasmid/construct used | Plasmid double cross-over | ||||||||||||||||||||||||
PlasmoGEM (Sanger) construct/vector used | No | ||||||||||||||||||||||||
Modified PlasmoGEM construct/vector used | No | ||||||||||||||||||||||||
Plasmid/construct map | |||||||||||||||||||||||||
Plasmid/construct sequence |
GGGCCCCCCCTCGAGGTCGACGGTATCGATGTATTTGATTTATTAGTTGTGTGTCAAAAA
| ||||||||||||||||||||||||
Restriction sites to linearize plasmid | ClaI, BamHI | ||||||||||||||||||||||||
Partial or complete disruption of the gene | Complete | ||||||||||||||||||||||||
Additional remarks partial/complete disruption | |||||||||||||||||||||||||
Selectable marker used to select the mutant parasite | tgdhfr | ||||||||||||||||||||||||
Promoter of the selectable marker | pbdhfr | ||||||||||||||||||||||||
Selection (positive) procedure | pyrimethamine | ||||||||||||||||||||||||
Selection (negative) procedure | No | ||||||||||||||||||||||||
Additional remarks genetic modification | |||||||||||||||||||||||||
Additional remarks selection procedure | |||||||||||||||||||||||||
Primer information: Primers used for amplification of the target sequences
Primer information: Primers used for amplification of the target sequences
| |||||||||||||||||||||||||
top of page |