top of page |
Type and details of transgene |
Is the transgene Plasmodium derived |
Transgene: not Plasmodium |
Transgene name | Nanoluciferase |
top of page |
Details of the genetic modification |
Inducable system used | No |
Additional remarks inducable system |
|
Type of plasmid/construct | (Linear) plasmid double cross-over |
PlasmoGEM (Sanger) construct/vector used | No |
Modified PlasmoGEM construct/vector used | No
|
Plasmid/construct map |
|
Plasmid/construct sequence |
|
Restriction sites to linearize plasmid |
|
Selectable marker used to select the mutant parasite | No selectable marker |
Promoter of the selectable marker | No |
Selection (positive) procedure | No |
Selection (negative) procedure | 5-fluorocytosine (5-FC) |
Additional remarks genetic modification | To construct the plasmid for generating the Ookluc strain, the 1590 base pairs upstream the genomic sequence of the P. berghei “circumsporozoite protein and thrombospondin-related adhesive protein [TRAP]-related protein” (CTRP, PBANKA_0412900) were PCR-amplified using primers forward GGGCTGCAGCCACTTCCTCAAAATGAATAGG (PstI restriction site underlined) and reverse GGATCCTTGTGTTTTGCTTTGTATTTAAA (BamHI restriction site underlined). The coding sequence of Nanoluciferase (nLuc) was PCR-amplified from the plasmid PfNluc using primers forward GGATCCATGGTCTTCACACTCGAAG (BamHI restriction site underlined) and reverse GATATCTTACGCCAGAATGCGTTCG (EcoRV restriction site underlined). The 551 base pairs downstream (3’UTR) the genomic sequence of the P. berghei Thrombospondin-related Adhesive Protein (TRAP, PBANKA_1349800) were PCR-amplified using primers forward GATATCTTTTAATAAACATATATATCTAGAT EcoRV restriction site underlined) and reverse GCGGCCGCCATCGCTGCATTAATGATTT (NotI restriction site underlined). The amplified sequences were cloned into the plasmid pL0043 (19), designed for transfection of the P. berghei GIMO line, using the restriction sites PstI, BamHI, EcoRV and NotI (FastDigest, Thermo Scientific) to generate the plasmid p43-Ookluc. |
Additional remarks selection procedure | This transgenic parasite does not contain a drug-selectable marker.
The mutant has been generated in the reference line GIMOPbANKA (RMgm-687). The GIMO mother line is used for introduction of transgenes into the modified 230p locus through transfection with constructs that target the 230p locus. These constructs insert into the 230p locus (‘gene insertion’), thereby removing the hdhfr::yfcu selectable marker (‘marker out’) from the genome of the mother lines. Transgenic parasites that are marker-free are subsequently selected by applying negative drug selection using 5-FC. This selection procedure is performed in vivo in mice. |
top of page |
Other details transgene |
top of page |
Promoter |
Gene Model of Parasite |
PBANKA_0412900
|
Gene Model P. falciparum ortholog |
PF3D7_0315200
|
Gene product | circumsporozoite- and TRAP-related protein |
Gene product: Alternative name | CTRP |
Primer information details of the primers used for amplification of the promoter sequence
Primer information details of the primers used for amplification of the promoter sequence
Sequence Primer 1 | |
Additional information primer 1 | |
Sequence Primer 2 | |
Additional information primer 2 | |
|
|
top of page |
3'-UTR |
Gene Model of Parasite |
PBANKA_1349800
|
Gene product | thrombospondin-related anonymous protein | sporozoite surface protein 2 |
Gene product: Alternative name | sporozoite surface protein 2; SSP2; SSP-2; TRAP |
Primer information details of the primers used for amplification the 3'-UTR sequences
Primer information details of the primers used for amplification the 3'-UTR sequences
Sequence Primer 1 | |
Additional information primer 1 | |
Sequence Primer 2 | |
Additional information primer 2 | |
|
|
Insertion/Replacement locus |
Replacement / Insertion | Replacement locus |
Gene Model of Parasite |
PBANKA_0306000
|
Gene product | 6-cysteine protein |
Gene product: Alternative name | 230p |
Primer information details of the primers used for amplification of the target sequences
Primer information details of the primers used for amplification of the target sequences
Sequence Primer 1 | |
Additional information primer 1 | |
Sequence Primer 2 | |
Additional information primer 2 | |
Sequence Primer 3 | |
Additional information primer 3 | |
Sequence Primer 4 | |
Additional information primer 4 | |
|
|
top of page |