SummaryRMgm-350
|
||||||||
*RMgm-350| Successful modification | The parasite was generated by the genetic modification | ||||||||||||||||||||||||
| The mutant contains the following genetic modification(s) | Gene disruption | ||||||||||||||||||||||||
| Reference (PubMed-PMID number) |
Reference 1 (PMID number) : 20386715 | ||||||||||||||||||||||||
| MR4 number | |||||||||||||||||||||||||
| top of page | |||||||||||||||||||||||||
| Parent parasite used to introduce the genetic modification | |||||||||||||||||||||||||
| Rodent Malaria Parasite | P. berghei | ||||||||||||||||||||||||
| Parent strain/line | P. berghei ANKA | ||||||||||||||||||||||||
| Name parent line/clone | P. berghei ANKA cl15cy1 | ||||||||||||||||||||||||
| Other information parent line | A reference wild type clone from the ANKA strain of P. berghei (PubMed: PMID: 17406255). | ||||||||||||||||||||||||
| top of page | |||||||||||||||||||||||||
| The mutant parasite was generated by | |||||||||||||||||||||||||
| Name PI/Researcher | M.R. van Dijk; C.J. Janse | ||||||||||||||||||||||||
| Name Group/Department | Leiden Malaria Research Group | ||||||||||||||||||||||||
| Name Institute | Leiden University Medical Center | ||||||||||||||||||||||||
| City | Leiden | ||||||||||||||||||||||||
| Country | The Netherlands | ||||||||||||||||||||||||
| top of page | |||||||||||||||||||||||||
| Name of the mutant parasite | |||||||||||||||||||||||||
| RMgm number | RMgm-350 | ||||||||||||||||||||||||
| Principal name | 310cl1; 323cl1 | ||||||||||||||||||||||||
| Alternative name | Δp230 | ||||||||||||||||||||||||
| Standardized name | |||||||||||||||||||||||||
| Is the mutant parasite cloned after genetic modification | Yes | ||||||||||||||||||||||||
| top of page | |||||||||||||||||||||||||
| Phenotype | |||||||||||||||||||||||||
| Asexual blood stage | Not different from wild type | ||||||||||||||||||||||||
| Gametocyte/Gamete | Normal numbers of male and female gametocytes are produced. Male and female gamete formation is normal (escape from host red blood cell, formation of 8 motile male gametes). Male gametes are strongly affected in their fertility, resulting in nearly complete inhibition of ookinete formation in vitro (>0.99%). Motile males fail to attach to and penetrate female gametes. Mutant female gametes are fertile as shown by cross-fertilisation with wild type male gametes. | ||||||||||||||||||||||||
| Fertilization and ookinete | Male gametes are strongly affected in their fertility, resulting in nearly complete inhibition of ookinete formation in vitro (>0.99%); Motile males fail to attach to and penetrate female gametes. Mutant female gametes are fertile as shown by cross-fertilization with wild type male gametes. Mutant parasites produce low numbers of ookinetes in vivo (Anopheles stephensi). See also 'Additional remarks phenotype'. | ||||||||||||||||||||||||
| Oocyst | Not different from wild type | ||||||||||||||||||||||||
| Sporozoite | Not different from wild type | ||||||||||||||||||||||||
| Liver stage | Not different from wild type | ||||||||||||||||||||||||
| Additional remarks phenotype | Mutant/mutation In P. falciparum it has been shown that male gametes with a disrupted p230 gene are incapable of interacting with erythrocytes and do not form the characteristic exflagellation centers and these mutants show a strong reduction in oocyst formation (Eksi et al, 2006, Mol. Microbiol. 61, 991-998). In the P. berghei mutants lacking P230, analyses of both exflagellating microgametocytes and free, motile male gametes in live preparations did not reveal any difference in their capacity to interact with red blood cells compared to wild type gametes and normal exflagellation centers were observed. Table: P. falciparum gene members of the 6-cys family
| ||||||||||||||||||||||||
Disrupted: Mutant parasite with a disrupted gene| top of page | |||||||||||||||||||||||||
| Details of the target gene | |||||||||||||||||||||||||
| Gene Model of Rodent Parasite | PBANKA_0306100 | ||||||||||||||||||||||||
| Gene Model P. falciparum ortholog | PF3D7_0209000 | ||||||||||||||||||||||||
| Gene product | 6-cysteine protein | transmission-blocking target antigen s230 | ||||||||||||||||||||||||
| Gene product: Alternative name | P230 | ||||||||||||||||||||||||
| top of page | |||||||||||||||||||||||||
| Details of the genetic modification | |||||||||||||||||||||||||
| Inducable system used | No | ||||||||||||||||||||||||
| Additional remarks inducable system | |||||||||||||||||||||||||
| Type of plasmid/construct used | Plasmid double cross-over | ||||||||||||||||||||||||
| PlasmoGEM (Sanger) construct/vector used | No | ||||||||||||||||||||||||
| Modified PlasmoGEM construct/vector used | No | ||||||||||||||||||||||||
| Plasmid/construct map |
![]() | ||||||||||||||||||||||||
| Plasmid/construct sequence |
![]() ![]() GGGCCCCCCCTCGAGGTCGACGGTATCGATAAGCTTCATATTTTCCTAAAAGAGCTCCAT
| ||||||||||||||||||||||||
| Restriction sites to linearize plasmid | ClaI, BamHI | ||||||||||||||||||||||||
| Partial or complete disruption of the gene | Partial | ||||||||||||||||||||||||
| Additional remarks partial/complete disruption | Of the 4486bp coding region, nucleotides 831-1410 were disrupted | ||||||||||||||||||||||||
| Selectable marker used to select the mutant parasite | tgdhfr | ||||||||||||||||||||||||
| Promoter of the selectable marker | pbdhfr | ||||||||||||||||||||||||
| Selection (positive) procedure | pyrimethamine | ||||||||||||||||||||||||
| Selection (negative) procedure | No | ||||||||||||||||||||||||
| Additional remarks genetic modification | |||||||||||||||||||||||||
| Additional remarks selection procedure | |||||||||||||||||||||||||
|
Primer information: Primers used for amplification of the target sequences
![]() Primer information: Primers used for amplification of the target sequences
| |||||||||||||||||||||||||
| top of page | |||||||||||||||||||||||||