RMgmDB - Rodent Malaria genetically modified Parasites
SummaryRMgm-318
|
||||||||||
Last modified: 28 August 2011, 18:05
*RMgm-318| Successful modification | The gene/parasite could not be changed/generated by the genetic modification. |
| The following genetic modifications were attempted | Gene disruption |
| Number of attempts to introduce the genetic modification | 2 |
| Reference (PubMed-PMID number) | Not published (yet) |
| top of page | |
| Parent parasite used to introduce the genetic modification | |
| Rodent Malaria Parasite | P. berghei |
| Parent strain/line | P. berghei ANKA |
| Name parent line/clone | RMgm-7 |
| Other information parent line | RMgm-7 is a P.berghei ANKA line (507cl1) which constitutively expresses GFP under control of the eukaryotic elongation factor-1α (eef1a) promoter of P. berghei |
| top of page | |
| Attempts to generate the mutant parasite were performed by | |
| Name PI/Researcher | G.R. Mair, C.J. Janse, A.P. Waters |
| Name Group/Department | Leiden Malaria Research Group |
| Name Institute | Leiden University Medical Center |
| City | Leiden |
| Country | The Netherlands |
Disrupted: Mutant parasite with a disrupted gene| top of page | |||||||||||||||||||||||||
| Details of the target gene | |||||||||||||||||||||||||
| Gene Model of Rodent Parasite | PBANKA_1426200 | ||||||||||||||||||||||||
| Gene Model P. falciparum ortholog | PF3D7_0811300 | ||||||||||||||||||||||||
| Gene product | CCR4-associated factor 1 | poly(A) ribonuclease POP2 | ||||||||||||||||||||||||
| Gene product: Alternative name | |||||||||||||||||||||||||
| top of page | |||||||||||||||||||||||||
| Details of the genetic modification | |||||||||||||||||||||||||
| Inducable system used | No | ||||||||||||||||||||||||
| Additional remarks inducable system | |||||||||||||||||||||||||
| Type of plasmid/construct used | Plasmid double cross-over | ||||||||||||||||||||||||
| PlasmoGEM (Sanger) construct/vector used | No | ||||||||||||||||||||||||
| Modified PlasmoGEM construct/vector used | No | ||||||||||||||||||||||||
| Plasmid/construct map |
  .png)
| ||||||||||||||||||||||||
| Plasmid/construct sequence |
GCGGATAACAATTTCACACAGGAAACAGCTATGACCATGATTACGCCAAGCTCGAAATTA
| ||||||||||||||||||||||||
| Restriction sites to linearize plasmid | |||||||||||||||||||||||||
| Partial or complete disruption of the gene | Partial | ||||||||||||||||||||||||
| Additional remarks partial/complete disruption |
The carbon catabolite repressor protein 4 (CCR4)-Not complex is a well-conserved, eukaryotic gene regulatory complex, broadly divided into two modules: CCR4 and CCR4-associated factor 1 (CAF1), regulating mRNA decay, and the Not proteins, regulating transcription and protein degradation. In yeast and other eukaryotes, CAF1 has a major role in determining transcript levels through regulated deadenylation of mRNA. Members of the CCR4-Not complex are well conserved in all Plasmodium species, suggestive of their significance in parasite gene regulation. The unsuccessful attempts to disrupt caf1 indicates an essential role during asexual blood stage development of P. berghei. In P. falciparum a 'CAF1-knock out mutant' has been generated and selected by piggyBac-mediated mutagenesis. Asexaul blood stages of this mutant show a severely attenuated growth rate. Phenotype analyses of the P. falciparum mutant indicates that the average number of merozoites/schizont and the length of the cell cycle is similar to that of wild type parasites. However, merozoites show a defect in egress from the host erythrocyte. The construct used here for disruption of P. berghei caf1 was aimed to disrupt the first exon and a large part of the second exon of the 3 exons. See RMgm-639 for independent attempts to disrupt P. berghei caf1 | ||||||||||||||||||||||||
| Selectable marker used to select the mutant parasite | tgdhfr | ||||||||||||||||||||||||
| Promoter of the selectable marker | pbdhfr | ||||||||||||||||||||||||
| Selection (positive) procedure | pyrimethamine | ||||||||||||||||||||||||
| Selection (negative) procedure | No | ||||||||||||||||||||||||
| Additional remarks genetic modification | |||||||||||||||||||||||||
| Additional remarks selection procedure | |||||||||||||||||||||||||
|
Primer information: Primers used for amplification of the target sequences
Primer information: Primers used for amplification of the target sequences
| |||||||||||||||||||||||||
| top of page | |||||||||||||||||||||||||