Summary

RMgm-314
Malaria parasiteP. berghei
Genotype
DisruptedGene model (rodent): PBANKA_1034400; Gene model (P.falciparum): PF3D7_1407800; Gene product: plasmepsin IV (PM4, plasmepsin 4)
Phenotype Asexual bloodstage;
Last modified: 4 March 2010, 23:59
  *RMgm-314
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene disruption
Reference (PubMed-PMID number) Reference 1 (PMID number) : 20019192
MR4 number
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone P. berghei ANKA 2.34
Other information parent lineP. berghei ANKA 2.34 is a cloned, gametocyte producer line of the ANKA strain (PubMed: PMID: 15137943).
The mutant parasite was generated by
Name PI/ResearcherR. Spaccapelo; C.J. Janse; J.B. Dame; A. Crisanti
Name Group/DepartmentDepartment of Experimental Medicine
Name InstituteUniversity of Perugia
CityPerugia
CountryItaly
Name of the mutant parasite
RMgm numberRMgm-314
Principal nameΔpm4cl1; Δpm4cl6
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
Phenotype
Asexual blood stageAsexual blood stages show a slightly reduced growth rate and show a virulence-attenuated phenotype in mice (see 'Additional remarks phenotype').
Gametocyte/GameteNot tested
Fertilization and ookineteNot tested
OocystNot tested
SporozoiteNot tested
Liver stageNot tested
Additional remarks phenotype

Mutant/mutation
The mutant lacks expression of Plasmepsin 4 (PM4; plasmepsin IV)

Protein (function)
Plasmepsin4 is an aspartic protease of the digestive vacuole and is involved in hemoglobin degradation. P. falciparum has four genes encoding digestive vacuole plasmepsins. Most other Plasmodium species, including P. berghei, have only a single gene encoding a digestive vacuole plasmepsin, plasmepsin4.

Phenotype
Asexual blood stages show a slightly reduced growth rate. A prolonged, less synchronized cell cycle in combination with a delayed and somewhat reduced schizont maturation process results in a slightly reduced multiplication rate in vivo.

The mutant shows a virulence-attenuated phenotype in mice. Blood stages of the mutant are significantly less virulent than wild type P. berghei parasites. Mutant parasites failed to induce experimental cerebral malaria (ECM) in ECM-susceptible mice (i.e. C57Bl/6) and ECM-resistant mice (i.e. BALB/c) were able to clear infections.

In vivo imaging of CD36-mediated sequestration of the schizont stage indicates that CD36-mediated sequestration is comparable to wild type (see also RMgm-32 for the method of in vivo imaging by measuring bioluminescence of the schizonts).

Additional information
After a single infection all convalescent mice were protected against subsequent parasite challenge for at least one year. Real-time in vivo parasite imaging and splenectomy experiments demonstrated that protective immunity acted through antibody-mediated parasite clearance in the spleen. This study shows that a single  gene disruption can generate virulence-attenuated parasites that do not induce cerebral complications and, moreover, are able to stimulate strong protective immunity against subsequent challenge with wild type parasites.

Other mutants
RMgm-315: An independent mutant lacking expression of Plasmepsin4
RMgm-316: A mutant lacking expression of Plasmepsin4 and expressing the reporter protein GFP-Luciferase under the control of the schizont-specific ama-1 promoter


  Disrupted: Mutant parasite with a disrupted gene
Details of the target gene
Gene Model of Rodent Parasite PBANKA_1034400
Gene Model P. falciparum ortholog PF3D7_1407800
Gene productplasmepsin IV
Gene product: Alternative namePM4, plasmepsin 4
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct usedPlasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid SacII, PvuII
Partial or complete disruption of the geneComplete
Additional remarks partial/complete disruption
Selectable marker used to select the mutant parasitetgdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modification
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1ccgggccctacaaaatattttcataagttggc
Additional information primer 1Sense (ApaI); 5'UTR 945bp
Sequence Primer 2ccatcgatttccattttgaactaattaaag
Additional information primer 2Antisense (ClaI); 5'UTR 945bp
Sequence Primer 3gggaattcttatatatgatatattacacgtac
Additional information primer 3Sense (EcoRI); 3'UTR 813bp
Sequence Primer 4cgggatccatggttttacgatttaaactttc
Additional information primer 4Antisense (BamHI); 3'UTR 813bp
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6