Summary

RMgm-275
Malaria parasiteP. yoelii
Genotype
Genetic modification not successful
DisruptedGene model (rodent): PY17X_1337400; Gene model (P.falciparum): Not available; Gene product: duffy receptor, beta form precursor (erythrocyte binding like protein, EBL; PyEBL)
PhenotypeNo phenotype has been described
Last modified: 16 June 2009, 09:02
  *RMgm-275
Successful modificationThe gene/parasite could not be changed/generated by the genetic modification.
The following genetic modifications were attempted Gene disruption
Number of attempts to introduce the genetic modification 4
Reference (PubMed-PMID number) Reference 1 (PMID number) : 19346470
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. yoelii
Parent strain/lineP. y. yoelii 17X
Name parent line/clone Not applicable
Other information parent lineAttempts to disrupt the gene were performed in both the 17X (lethal) and 17XNL (not lethal) strain of P. yoelii
Attempts to generate the mutant parasite were performed by
Name PI/ResearcherH. Otsuki; M. Torii
Name Group/DepartmentDepartment of Molecular Parasitology
Name InstituteEhime University Graduate School of Medicine
CityToon, Ehime
CountryJapan

  Disrupted: Mutant parasite with a disrupted gene
Details of the target gene
Gene Model of Rodent Parasite PY17X_1337400
Gene Model P. falciparum ortholog Not available
Gene productduffy receptor, beta form precursor
Gene product: Alternative nameerythrocyte binding like protein, EBL; PyEBL
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct usedPlasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid
Partial or complete disruption of the geneComplete
Additional remarks partial/complete disruption
Selectable marker used to select the mutant parasitehdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modificationSee Otsuki et. al., PNAS 2009 106:7167-72 for detailed information about generation of the pR6Cyt-B12 construct which was used to create the pR6Cyt + 5U-B12 knock out construct (see supporting information).

PY04764 is a gene encoding a type I integral transmembrane protein encoded by the ebl (erythrocyte-binding-like) gene family. Upon release from the micronemes, EBL proteins recognize erythrocyte receptors and initiate the formation of the tight junction. Plasmodium vivax uses an EBL orthologue, PvDBP (Pv110810), to recognize the Duffy antigen on the erythrocyte surface.
P. falciparum has an expanded family of EBL proteins, for example EBA175 (PF07_0128), EBA181/JESEBL (PFA0125c), EBA140/BAEBL (MAL13P1.60), EBL1 (PFD1145c).
EBL proteins possess 2 Cys-rich regions conserved among EBL orthologues. The N-terminal Cys-rich region named the DBL (Duffy-binding-like) domain or region 2 recognizes a specific erythrocyte surface receptor. The C-terminal Cys-rich region named the C-cys domain or region 6 is located adjacent to the transmembrane domain, and the number and location of Cys residues are well conserved among known Plasmodium species. Region 6 exhibits structural similarity to the KIX-binding domain of the coactivator CREB-binding protein and has been proposed to be a protein trafficking signal for transportation to the micronemes.

See RMgm-276 and RMgm-277 for mutants ecoding mutated forms of the protein encoded by Pv110810.
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1ACCAAATGCATAGAGTTTTA
Additional information primer 15' target
Sequence Primer 2AAATTGATTCTTCTACTTGGTATG
Additional information primer 25' target
Sequence Primer 3gCCATGGGAACATAGAGACATTAAAAAAAGC
Additional information primer 3pyebl region 6 to the stop codon (NcoI)
Sequence Primer 4gCTCGAGATAAAAATCTACAGGTATATATTC
Additional information primer 4pyebl region 6 to the stop codon (XhoI)
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6