Summary

RMgm-265
Malaria parasiteP. berghei
Genotype
DisruptedGene model (rodent): PBANKA_0915600; Gene model (P.falciparum): PF3D7_1132800; Gene product: aquaglyceroporin
Phenotype Asexual bloodstage; Sporozoite;
Last modified: 2 February 2018, 16:47
  *RMgm-265
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene disruption
Reference (PubMed-PMID number) Reference 1 (PMID number) : 17284593
Reference 2 (PMID number) : 29330527
MR4 number
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone Not applicable
Other information parent line
The mutant parasite was generated by
Name PI/ResearcherD. Promeneur, N. Kumar
Name Group/DepartmentJohns Hopkins Malaria Research Institute, Department of Molecular Microbiology and Immunology
Name InstituteJohns Hopkins Bloomberg School of Public Health
CityBaltimore
CountryUSA
Name of the mutant parasite
RMgm numberRMgm-265
Principal namePbAQP-null parasites
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
Phenotype
Asexual blood stageBlood stages were viable and morphologically indistinguishable from wild type parasites in Giemsa-stained blood smears. Mutant parasites had a slightly reduced growth rate in 4-week-old naïve female Swiss–Webster mice and mice infected with mutant parasites exhibited a more prolonged survival as compared with wild type parasites.
Gametocyte/GameteNot tested
Fertilization and ookineteNot tested
OocystNot tested
SporozoiteNormal sporozoite formation. Reduced infectivity of sporozoites to mice (strong increase in prepatent period; 4-5 days longer). Normal invasion of hepatocytes. Strongly reduced growth/replication with hepatocytes. Mutants produce smaller merosomes that appear later during infection.
Liver stageNot tested
Additional remarks phenotype

Mutant/mutation
The mutant lacks expression of aquaglyceroporin (AQP).

Protein (function)
Aquaporins constitute a family of cellular water and solute channels. They are functionally divided into two groups, the aquaporins, which are water-specific channels, and aquaglyceroporins, which are highly permeated by glycerol and other solutes and variably permeated by water. Aquaglyceroporins are the only glycerol channels identified in mammals. A single aquaglyceroporin is present in the genome of  P. falciparum (PfAQP). PfAQP has significant homology with the Escherichia coli glycerol facilitator GlpF, and is expressed during various intraerythocytic stages of the parasite where it is localized to the parasite plasma membrane.

Phenotype
Phenotype analyses have been reported in the two references mentioned above
The phenotype analyses indicate that AQP is not essential for blood stage development. Blood stages were viable and morphologically indistinguishable from WT parasites in Giemsa-stained blood smears. Mutant parasites had a slightly reduced growth rate in 4-week-old naïve female Swiss–Webster mice and mice infected with mutant parasites exhibited a more prolonged survival as compared with wild type parasites.

Compared to wild-type parasites, PbAQP-null sporozoites exhibit a delay in blood stage infection due to slower replication in hepatocytes, resulting in retardation of merosome production. Furthermore, PbAQP disruption results in a significant reduction in erythrocyte infectivity by hepatocyte-derived merozoites

Additional information
Expression of AQP was analysed by Western and IFA using a rabbit polyclonal antibody against a synthetic peptide corresponding to the last 17 amino acids of the C terminus of AQP. AQP was expressed in all blood stages with a clear increase in expression in trophozoite and schizont stages. AQP was localized at the parasite plasma membrane in all of the intraerythrocytic forms. There was no PbAQP staining observed at the erythrocyte plasma membrane or in the erythrocyte cytosol.

The uptake of the radiolabeled glycerol into the erythrocytes infected with mutant parasites was low compared with erythrocytes infected with wild type parasites and similar to that observed in uninfected erythrocytes.

RT-PCR analyses show: PbAQP is expressed in the sporozoite mosquito stage and is detected at low levels in intrahepatic parasites at the onset of hepatocyte infection. As the parasites progress to late hepatic stages, PbAQP transcription increases and PbAQP localizes to the plasma membrane of hepatic merozoites (as shown by IFA using anti-PbAQP antibodies).

Evidence is presented that: 'Hepatic merozoites incorporate exogenous glycerol into glycerophospholipids and PbAQP-null merozoites contain less phosphatidylcholine than wild-type merozoites, underlining the contribution of Plasmodium AQP to phospholipid syntheses'.

Other mutants


  Disrupted: Mutant parasite with a disrupted gene
Details of the target gene
Gene Model of Rodent Parasite PBANKA_0915600
Gene Model P. falciparum ortholog PF3D7_1132800
Gene productaquaglyceroporin
Gene product: Alternative name
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct used(Linear) plasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid
Partial or complete disruption of the geneComplete
Additional remarks partial/complete disruption
Selectable marker used to select the mutant parasitetgdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modification
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1GGTACCGTATCCAATAGCATATACATTTTC
Additional information primer 1forward primer P410 (5', ~600bp)
Sequence Primer 2AAGCTTCATAATTATGCAAAATGTAAC
Additional information primer 2reverse primer P411 (5', ~600bp)
Sequence Primer 3GGATCCGAGACTGCATACTATGTTATTATC
Additional information primer 3forward primer P412 (3', ~600bp)
Sequence Primer 4GCGGCCGCGTCTTGTCGTCACAAAGTAG
Additional information primer 4reverse primer P413 (3', ~600bp)
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6