Summary

RMgm-264
Malaria parasiteP. berghei
Genotype
Genetic modification not successful
DisruptedGene model (rodent): PBANKA_0209300; Gene model (P.falciparum): PF3D7_0103800; Gene product: actin-related protein (ARP1; actin3)
PhenotypeNo phenotype has been described
Last modified: 29 June 2010, 14:08
  *RMgm-264
Successful modificationThe gene/parasite could not be changed/generated by the genetic modification.
The following genetic modifications were attempted Gene disruption
Number of attempts to introduce the genetic modification 3
Reference (PubMed-PMID number) Reference 1 (PMID number) : 20580650
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone P. berghei ANKA cl15cy1
Other information parent lineA reference wild type clone from the ANKA strain of P. berghei (PubMed: PMID: 17406255).
Attempts to generate the mutant parasite were performed by
Name PI/ResearcherI. Siden-Kiamos, C. Louis
Name Group/DepartmentInstitute of Molecular Biology and Biotechnology
Name InstituteFoundation for Research and Technology – Hellas, Vassilika Vouton
CityHeraklion, Crete
CountryGreece

  Disrupted: Mutant parasite with a disrupted gene
Details of the target gene
Gene Model of Rodent Parasite PBANKA_0209300
Gene Model P. falciparum ortholog PF3D7_0103800
Gene productactin-related protein
Gene product: Alternative nameARP1; actin3
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct usedPlasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid
Partial or complete disruption of the genePartial
Additional remarks partial/complete disruption
Selectable marker used to select the mutant parasitetgdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modificationDisruption experiments were performed in the Leiden Malaria Research Group (Exp. 250, 307, 315; plasmid JR16, obtained from I. Siden-Kiamos) and by K. Matuschweski.

Attempts to delete the gene in the parasite were unsuccessful, suggesting that ARP1 is essential during blood stage development.

Transcription of arp1 was shown to be upregulated in ookinetes compared to gametocytes and asexual blood stages.

Western analysis using antiserum against the recombinant protein expressed in bacteria, showed expression in all stages.

Actin-related proteins (Arp’s) have a high degree of sequence similarity to conventional actins, their three dimensional structure also being conserved. However, their functions are varied and distinct from that of conventional actins. To date 11 distinct subfamilies of Arp’s from a wide range of eukaryotic organisms have been described, each subfamily having a distinct function. Arp2 and Arp3 are absent in apicomplexan parasites. Arp’s 4-9 have a function in the nucleus; in chromatin remodelling, histone modification and regulation of DNA repair. Only one Arp, namely Arp1, has been shown to form a filamentous homopolymer, with a uniform size of ~40 nm. In addition, similar to actin, it is regulated by ATP turnover. The Arp1 minifilament is a component of the dynactin complex, which is required for dynein transport on microtubules. Dynactin, in turn, which is a large multi-subunit complex, has a function both in mitosis and in vesicular transport. Arp 11 acts as a capping protein on the pointed end of the Arp1 filament in the dynactin complex, at least in some organisms. Genomic sequence analysis of apicomplexan parasites has suggested that several of the subunits of the dynactin complex are present in these parasites.
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1ATATAATGAACGAATATGGTAATCAGC
Additional information primer 1A3KO56F (size 531bp)
Sequence Primer 2AATATTTTCCATTGTCATTCCAATTTTC
Additional information primer 2A3KO56R (size 531bp)
Sequence Primer 3ATATTGCTGGGCGAGATATTAC
Additional information primer 3A3KO3F (507 bp)
Sequence Primer 4AGGAAGCTAATATTGACCCTCC
Additional information primer 4A3KO3R (507 bp)
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6