Summary

RMgm-255
Malaria parasiteP. berghei
Genotype
Genetic modification not successful
DisruptedGene model (rodent): PBANKA_1232200; Gene model (P.falciparum): PF3D7_0517400; Gene product: FACT complex subunit SPT16, putative (FACT-L; FACT)
PhenotypeNo phenotype has been described
Last modified: 22 September 2011, 11:16
  *RMgm-255
Successful modificationThe gene/parasite could not be changed/generated by the genetic modification.
The following genetic modifications were attempted Gene disruption
Number of attempts to introduce the genetic modification 3
Reference (PubMed-PMID number) Not published (yet)
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone P. berghei ANKA 507cl1 (RMgm-7)
Other information parent lineP.berghei ANKA 507cl1 (RMgm-7) is a reference ANKA mutant line which expresses GFP under control of a constitutive promoter (PubMed: PMID: 16242190).
Attempts to generate the mutant parasite were performed by
Name PI/ResearcherE. Laurentino, C.J. Janse
Name Group/DepartmentLeiden Malaria Research Group
Name InstituteLeiden University Medical Center
CityLeiden
CountryThe Netherlands

  Disrupted: Mutant parasite with a disrupted gene
Details of the target gene
Gene Model of Rodent Parasite PBANKA_1232200
Gene Model P. falciparum ortholog PF3D7_0517400
Gene productFACT complex subunit SPT16, putative
Gene product: Alternative nameFACT-L; FACT
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct usedPlasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Click to view information
Click to hide information
Plasmid/construct sequence
Click to view information
Click to hide information
AATTCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACTT
AATCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGGCGTAATAGCGAAGAGGCCCGCACC
GATCGCCCTTCCCAACAGTTGCGCAGCCTGAATGGCGAATGGCGCCTGATGCGGTATTTT
CTCCTTACGCATCTGTGCGGTATTTCACACCGCATATGGTGCACTCTCAGTACAATCTGC
TCTGATGCCGCATAGTTAAGCCAGCCCCGACACCCGCCAACACCCGCTGACGCGCCCTGA
CGGGCTTGTCTGCTCCCGGCATCCGCTTACAGACAAGCTGTGACCGTCTCCGGGAGCTGC
ATGTGTCAGAGGTTTTCACCGTCATCACCGAAACGCGCGAGACGAAAGGGCCTCGTGATA
CGCCTATTTTTATAGGTTAATGTCATGATAATAATGGTTTCTTAGACGTCAGGTGGCACT
TTTCGGGGAAATGTGCGCGGAACCCCTATTTGTTTATTTTTCTAAATACATTCAAATATG
TATCCGCTCATGAGACAATAACCCTGATAAATGCTTCAATAATATTGAAAAAGGAAGAGT
ATGAGTATTCAACATTTCCGTGTCGCCCTTATTCCCTTTTTTGCGGCATTTTGCCTTCCT
GTTTTTGCTCACCCAGAAACGCTGGTGAAAGTAAAAGATGCTGAAGATCAGTTGGGTGCA
CGAGTGGGTTACATCGAACTGGATCTCAACAGCGGTAAGATCCTTGAGAGTTTTCGCCCC
GAAGAACGTTTTCCAATGATGAGCACTTTTAAAGTTCTGCTATGTGGCGCGGTATTATCC
CGTATTGACGCCGGGCAAGAGCAACTCGGTCGCCGCATACACTATTCTCAGAATGACTTG
GTTGAGTACTCACCAGTCACAGAAAAGCATCTTACGGATGGCATGACAGTAAGAGAATTA
TGCAGTGCTGCCATAACCATGAGTGATAACACTGCGGCCAACTTACTTCTGACAACGATC
GGAGGACCGAAGGAGCTAACCGCTTTTTTGCACAACATGGGGGATCATGTAACTCGCCTT
GATCGTTGGGAACCGGAGCTGAATGAAGCCATACCAAACGACGAGCGTGACACCACGATG
CCTGTAGCAATGGCAACAACGTTGCGCAAACTATTAACTGGCGAACTACTTACTCTAGCT
TCCCGGCAACAATTAATAGACTGGATGGAGGCGGATAAAGTTGCAGGACCACTTCTGCGC
TCGGCCCTTCCGGCTGGCTGGTTTATTGCTGATAAATCTGGAGCCGGTGAGCGTGGGTCT
CGCGGTATCATTGCAGCACTGGGGCCAGATGGTAAGCCCTCCCGTATCGTAGTTATCTAC
ACGACGGGGAGTCAGGCAACTATGGATGAACGAAATAGACAGATCGCTGAGATAGGTGCC
TCACTGATTAAGCATTGGTAACTGTCAGACCAAGTTTACTCATATATACTTTAGATTGAT
TTAAAACTTCATTTTTAATTTAAAAGGATCTAGGTGAAGATCCTTTTTGATAATCTCATG
ACCAAAATCCCTTAACGTGAGTTTTCGTTCCACTGAGCGTCAGACCCCGTAGAAAAGATC
AAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAA
CCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAG
GTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTCCTTCTAGTGTAGCCGTAGTTA
GGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTA
CCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAG
TTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTG
GAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCATTGAGAAAGCGCCACG
CTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAG
CGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGC
CACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAA
AACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATG
TTCTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGTGAGCT
GATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGAGCGAGGAAGCGGAA
GAGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGCAGCTGG
CACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGAGCGCAACGCAATTAATGTGAGTTAG
CTCACTCATTAGGCACCCCAGGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGA
ATTGTGAGCGGTAAACAATTTCACACAGGAAACAGCTTGACCATGATTACGCCAAGCTTG
GGCCCCCGCGGCATAAGGATATAAAAGGGGTTTATATATATACTAGCCATAAGTGTGCAT
ATAATTTTTGAACTTTGTAAAAACAAGCTAGCAAAAATGAGTGAAGGATTAGATGTAGAT
AACGCCAAAGAAAAGATAAACTTCATGTTTACATATTGGAAAAATATTAATAATAAGGAT
TTTGAAAATAGTAATGCATTCTGTATTTTATCGGGTAAATCTAGCAAAGATGATAATGCA
ACGATTCAAGAACAATTTCAGATGTGGCTTTTAGGATACCAACTAACAGAAACGTTTTTT
TTATTTTGTAAAAAAAATGAAAAACTAATAATACTCACAAGTGATAAAAAAAAAAAATTT
TTACAACCATTATTAGATAAAATGAATAATATAACAATTTTAGAAAGAAATAATAATGAT
AATAGTGAAAATTTTGAAAAAATAAAAAATGAAATAAATATGTTTAATGATAAAGAACTA
TTAATTTTAAAAGATAAAGATTCTACTGGAAGTTTTTTTGAAGCATGCTATGATTTTATT
AAAAATTTGAATAAAACTGAAATAGATGTAAATAATAATATAAAAAGTTTGTTAAATCTT
AGATCTAAATCAGATGTAAAATTACAAAAATCAGCTAGCGATATAGCTAGCATTATAATG
AAAAATGTTTTGATAACTACCATTGAAAATTCATTGGATAGTGAAGAATATGAAAGTCAT
AATAAAATAAAAGAAAAAGTTTTAAAATTTAATGAAAATAAAAAATGTGTTGTTAAGATA
AAGGATAAATTAAAAGCAGATATAGATGATATAGATGTTATATATAGTAGTGTACAAAGT
GGTAATAATTTTTTGTTAAATTTCAAAAATACTAATGATAATAATTATTTATCACAAAAT
GATGGTACTATAGTTATAGGTATAGGTGTCAAATATAAAGAATTGTGTGCAAATATAAAT
AGAACCTTATTATTAAATGCTAAAGAATATCATAAAGAACTTTATAATTTTACGTTTTCT
ATACAAAAATACATAATTAACGATTGTTTAAAATATAATACATCTTTTTCAGATGTATAT
AAAAAGGCAATGCAATATATTAAAGATAATAAACGAAACTATCAAACAATTGGAAATATA
AATTTAGAAAATTATTTTATAAAATGTTTGGGTCATGTTATAGGCTAGGCCTCTGCAGCC
CAGCTTAATTCTTTTCGAGCTCTTTATGCTTAAGTTTACAATTTAATATTCATACTTTAA
GTATTTTTTGTAGTATCCTAGATATTGTGCTTTAAATGCTCACCCCTCAAAGCACCAGTA
ATATTTTCATCCACTGAAATACCATTAAATTTTCAAAAAAATACTATGCATATAATGTTA
TACATATAAACATAAAACGCCATGTAAATCAAAAAATATATAAAAATATGTATAAAAATA
AATATGCACTAAATATAAGCTAATTATGCATAAAAATTAAAGTGCCCTTTATTAACTAGT
CGTAATTATTTATATTTCTATGTTATAAAAAAATCCTCATATAATAATATAATTAATATA
TGTAATGTTTTTTTTATTTTATAATTTTAATATAAAATAATATGTAAATTAATTCAAAAA
ATAAATATAATTGTTGTGAAACAAAAAACGTAATTTTTTCATTTGCCTTCAAAATTTAAA
TTTATTTTAATATTTCCTAAAATATATATACTTTGTGTATAAATATATAAAAATATATAT
TTGCTTATAAATAAATAAAAAATTTTATAAAACATAGGGGGATCCATGGTTGGTTCGCTA
AACTGCATCGTCGCTGTGTCCCAGAACATGGGCATCGGCAAGAACGGGGACCTGCCCTGG
CCACCGCTCAGGAACGAATTTAGATATTTCCAGAGAATGACCACAACCTCTTCAGTAGAA
GGTAAACAGAATCTGGTGATTATGGGTAAGAAGACCTGGTTCTCCATTCCTGAGAAGAAT
CGACCTTTAAAGGGTAGAATTAATTTAGTTCTCAGCAGAGAACTCAAGGAACCTCCACAA
GGAGCTCATTTTCTTTCCAGAAGTCTAGATGATGCCTTAAAACTTACTGAACAACCAGAA
TTAGCAAATAAAGTAGACATGGTCTGGATAGTTGGTGGCAGTTCTGTTTATAAGGAAGCC
ATGAATCACCCAGGCCATCTTAAACTATTTGTGACAAGGATCATGCAAGACTTTGAAAGT
GACACGTTTTTTCCAGAAATTGATTTGGAGAAATATAAACTTCTGCCAGAATACCCAGGT
GTTCTCTCTGATGTCCAGGAGGAGAAAGGCATTAAGTACAAATTTGAAGTATATGAGAAG
AATGATTAAGGATCCCGTTTTTCTTACTTATATATTTATACCAATTGATTGTATTTATAA
CTGTAAAAATGTGTATGTTGTGTGCATATTTTTTTTTGTGCATGCACATGCATGTAAATA
GCTAAAATTATGAACATTTTATTTTTTGTTCAGAAAAAAAAAACTTTACACACATAAAAT
GGCTAGTATGAATAGCCATATTTTATATAAATTAAATCCTATGAATTTATGACCATATTA
AAAATTTAGATATTTATGGAACATAATATGTTTGAAACAATAAGACAAAATTATTATTAT
TATTATTATTTTTACTGTTATAATTATGTTGTCTCTTCAATGATTCATAAATAGTTGGAC
TTGATTTTTAAAATGTTTATAATATGATTAGCATAGTTAAATAAAAAAAGTTGAAAAATT
AAAAAAAAACATATAAACACAAATGATGTTTTTTCCTTCAATTTCGATGGGTACCCTCGA
GGCTAGCGATATCTGATCACCCGGGGCGGCCGCGAATTCGAAATACCATATCCAGAATTA
ACATTTTCAGGTGTTCCAAACAAAAGTAATGTTGAAATATTTGTTACTGCCAATACTATT
AATCATTTAATTGAATGGCCACCTTTTATATTATCTGTAGAAGATATTGAAATTGCATCT
CTAGAAAGAGTACATCATGGTTTAAGAAACTTTGATATGATTTTTGTTTTTAAGGATTAT
ACTAAGCCTGTAAAAAGAATTGATGTTATACCTGTCGAATATATAGACACAATTAAAAAA
TGGCTAACTACTATTGACATAGTATATTATGAAGGAAAAAATAATCTTCAATGGGGAAAT
ATACTCAAAACTATTCTTGCAGATATTGAATCTTTTGTTAATTCCAAGGGATTTGATGGA
TTTTTAGGAGAAGATGATGATGAAGAAGAACAGTCTGCTGAAGATGAAGATGAGGACGAC
GAATATGAAGTTGATGAATCAGAAATGGTAAGTCAATCTCTATCTTTTAACTTTATCATC
ATGTTCTCTAATTTTGTTATTTTTCTAATTTTTTTGCATATTTACATTCCCTTTACTTCT
TTTTTTATTTTTCAGAGTGCAGAAGAAGACAGTGAATATGAAGACAGTGAAGAAGAAAGT
TTAGCCACAGAAAGTGATGGGGATGAAGAAGTTGAAGAAGACTCAGATGATGAAGGATTA
TCTTGGGACGAGCTTGAGGAAAGAGCTAAAAAAGGTAAACCCCAATATATACAGTAAAAT
GAGATGATTTTACTTTGGCTACTAATTTTAATTCCTGTTTATTGAAAACATAAATAGTAT
CTCCACATGTATCATGTATTTTTTTTTCTTTATTATTTTCTATTTCTTAGACGACAAAAA
ACGATTTGCATATCAAAGTGACGATGGTGATGATAGTGAAGGATACAATAAAAGAAAGAG
GAAAAAAAATTAATTTTACAAATCATTTATATTTTTTTTTTTCAATTATTAATTTTTGGC
TATTTTCATAACACTTTATTTTTATTTCATTCTGTTTATCATAATAAGCATATTATTACA
CACCCAATTGAAGTTCAAATATAAATATAGAAATAATCTTATTATTATTTGCAACTCGCT
TTTTTTTAGCATACATATTAATTATATTTTATTAGAGTAAGAAAATAAACATATATATGT
ACATTTATTTATATATATATCATTTTATACGTCTTTTGGCCTTTTTTACAAATGCCAAAC
AAAATTTTTGCAAATGTACACATACGTACGTCTATAATG
Restriction sites to linearize plasmid
Partial or complete disruption of the genePartial
Additional remarks partial/complete disruption PB000119.00.0 reads 3231 bp (PlasmoDB). The selectable marker was inserted between bp positions 1090 and 2502, replacing everything in between.
Selectable marker used to select the mutant parasitetgdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modificationThe unsuccessful ttempts to disrupt the fact-l gene in P. berghei indicates an essential role of FACT-L for blood stage development/multiplication.

See also RMgm-652, RMgm-653 and RMgm-654 for mutants in which the promoter of fact-l is replaced by an 'asexual blood stage specific’ promoter that is silent in gametocytes (the promoter of PBANKA_140060).

Disruption experiments were performed in the Leiden Malaria Research Group (Exp. 902, 917; pl1230)
An additional attempt to disrupt the gene was performed using a different plasmid targeting a bigger part of the gene (double cross-over integration; exp. 1147; pl1147). Primers used to amplify the target sequences are
L3576 (SacII): gcCCGCGGATGCAATCCTTATTAGTG; L3576 (StuI): gcAGGCCTCATCTGATTTAGATCTAAG; L3577 (XhoI): cCTCGAGCTAGAAAGAGTACATCATGG; L3578 (EcoRV): gcGATATCGCGTTCATTTCATATATAAC.
The selectable marker was inserted between bp positions 519 and 2742 of the PB000119.00.0 ORF, replacing everything in between.
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1GCCCCGCGGCATAAGGATATAAAAGGG
Additional information primer 1L2819 (SacII); 5'
Sequence Primer 2TCAAGGCCTAAGCCTATAACATGACCC
Additional information primer 2L2820 (StuI); 5'
Sequence Primer 3CTGATGAAttcATGCATGATGAAAT
Additional information primer 3L2779 (EcoRI); 3'
Sequence Primer 4ATTATAGACGTACGTATGTGTACA
Additional information primer 4L2780; 3'
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6