Summary

RMgm-248
Malaria parasiteP. berghei
Genotype
Genetic modification not successful
DisruptedGene model (rodent): PBANKA_0836300; Gene model (P.falciparum): PF3D7_0935800; Gene product: cytoadherence linked asexual protein 9 (CLAG9)
PhenotypeNo phenotype has been described
Last modified: 15 March 2012, 10:03
  *RMgm-248
Successful modificationThe gene/parasite could not be changed/generated by the genetic modification.
The following genetic modifications were attempted Gene disruption
Number of attempts to introduce the genetic modification 3
Reference (PubMed-PMID number) Not published (yet)
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone P. berghei ANKA cl15cy1
Other information parent lineA reference wild type clone from the ANKA strain of P. berghei (PubMed: PMID: 17406255).
Attempts to generate the mutant parasite were performed by
Name PI/ResearcherD.L. Gardiner, C.J. Janse, A.P. Waters
Name Group/DepartmentMalaria Biology Laboratory
Name InstituteQueensland Institute of Medical Researchal Center
CityHerston
CountryAustralia

  Disrupted: Mutant parasite with a disrupted gene
Details of the target gene
Gene Model of Rodent Parasite PBANKA_0836300
Gene Model P. falciparum ortholog PF3D7_0935800
Gene productcytoadherence linked asexual protein 9
Gene product: Alternative nameCLAG9
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct usedPlasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid
Partial or complete disruption of the genePartial
Additional remarks partial/complete disruption
Selectable marker used to select the mutant parasitetgdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modificationTwo P. berghei gene models: PB000829.03.0, PB000048.01.0

The following target regions were used in the construct to disrupt CLAG9:

Insert No1. In Hind III site 5'-3'
1 CTAAATCATAATGCCACTGTAGAAGATGTAATAAATTATGAACATATTTTAAAAGAACAA
61 GTGGCTTTAGAATACGACCCTTCGATATCAGATAAAATTAAAAATAAAATATTAATTGTG
121 AGAACTCTAAAAATTGTTAAGTTTATGTTGGTACCAATTTATGAGTTTAAAAAAAATAAA
181 GACATAAAACAAGCCTTATACAAATTAAATAATTTTTTTATTTATGATCATAAAAAAAGT
241 AAAAATCATGATTATTCCACTTCTAAATTAAAAAATGTAATTCGTGAAAATATGCTATAT
301 TCATCAAAATTTCTCAAAGTCAAAAATCAAATACCCCAAAATACCGATATCAATGAATAT
361 AATAATGACTACAAAGAAATATTATTTTCTTATGAACCTGATATTGAATATATGAAAAAC
421 CAAGATGCTATATCTAATTATTATGACATAGGCATATATAATCATATCGGAGCCCATTTA
481 TAAGTGCGCTATACATTTTCTGCATTCCCCATTTTGGCATTTCTACCATTTCTGTCATTT
541 TCGCCCCTTTTCGTTTTGCAGCGCTTGGTCATTTTATCACCCTCAAAATGGCATTCAAAC
601 ATTTCAAAAAATACTTTGTAAATGGAGATCTACGGGTTTATC

and

Insert No2 3' EcoR1 site. 5'-3'
1 CAAATGCTATGTTTCTAAATCTATATAATGAAACTAAACCCAAACTAACTATGATAACAT
61 TCCATTGGTACCCATCATATTTAAAGAAATTTATTATTCATTATGTTCGAAAAAATAAAG
121 CTGCATCTTTGTTAAATGGTAAATTTTAAAAATGACAAAATAATTTTTTTTTTTTTTTGC
181 ATTTCTTATATTCATCGGATTAATATTCACTCTTTTATCCATTTACAGAATTAGAAAGTA
241 AAGTAAAAAAAGAAACAATCGAAAAAATGAAAAATAGCATACGATTCGTTATGCACATTA
301 ATTTCAATATTACAATTAGACTTTTTTTATTATCTAAATGAAAAGCCTTTGAAAAATAGT
361 CATCCATATGGATTAACAATGCTAATTGAAAATAAATTTAAAGATTGGTTTATGAATTAC
421 CTAACAGGGTTTACTATGGTTAATTATGATGATAATAAAGGGCGTTATAATTTACCTGGA
481 AAACGTGAAAGGAGGGAATTTTTAGCATCAAAATTAAAAATGTGGACTTTATTTGTGAAA
541 AAAATTATAACTGATGCATATGTTCAAAACTTTAATCAAAAACATGTTATAAATTTATAT
601 AAATATCATGACATATTCAATATAAATAACAAAATTATGGTAATGAGGGATTCCTATGAA
661 CTTTATATC

Disruption experiments were performed in the Leiden Malaria Research Group (exp. 305, 306, 319)

RMgm-723 describes an independent attempt to disrupt PBANKA_083630
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1See Additional remarks genetic modification.
Additional information primer 1
Sequence Primer 2See Additional remarks genetic modification.
Additional information primer 2
Sequence Primer 3
Additional information primer 3
Sequence Primer 4
Additional information primer 4
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6