Summary

RMgm-241
Malaria parasiteP. berghei
Genotype
Genetic modification not successful
DisruptedGene model (rodent): PBANKA_1413100; Gene model (P.falciparum): PF3D7_1314600; Gene product: lipoate-protein ligase 1 (lipoic acid protein ligase A1)
PhenotypeNo phenotype has been described
Last modified: 1 March 2010, 13:28
  *RMgm-241
Successful modificationThe gene/parasite could not be changed/generated by the genetic modification.
The following genetic modifications were attempted Gene disruption
Number of attempts to introduce the genetic modification ≥ 5
Reference (PubMed-PMID number) Reference 1 (PMID number) : 19434237
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei NK65
Name parent line/clone Not applicable
Other information parent line
Attempts to generate the mutant parasite were performed by
Name PI/ResearcherS. Günther; K. Matuschewski; S. Müller
Name Group/DepartmentDivision of Infection & Immunity and Wellcome Centre for Parasitology, Faculty of Biomedical and Lif
Name InstituteUniversity of Glasgow
CityGlasgow
CountryUnited Kingdom, Scotland

  Disrupted: Mutant parasite with a disrupted gene
Details of the target gene
Gene Model of Rodent Parasite PBANKA_1413100
Gene Model P. falciparum ortholog PF3D7_1314600
Gene productlipoate-protein ligase 1
Gene product: Alternative namelipoic acid protein ligase A1
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct usedPlasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid KpnI/SacII
Partial or complete disruption of the geneComplete
Additional remarks partial/complete disruption
Selectable marker used to select the mutant parasitetgdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modificationGene disruptions in P. falciparum consistently were unsuccessful while in P. berghei the LplA1 gene locus was targeted by knock-in and knockout constructs. However, a LplA1(−) mutant could not be cloned suggesting a critical role of LplA1 for asexual parasite growth in vitro and in vivo.

In one out of six transfection experiments it was possible to amplify the diagnostic product for the PbLplA1 gene replacement after two rounds of PCR. This was verified by subcloning the PCR fragment and analysing its nucleotide sequence. However, this mutant parasite line was lost after transfer into a new animal - a procedure that is routinely performed to propagate the knockout parasite population and to be able to generate clones. These data support that the LplA1 locus can be targeted as was also shown using a control plasmid. However, the results suggest that the knockout of the LplA1 gene might have severe effects on parasite growth rate and survival during erythrocytic development.

In addition to the double homologous recombination approach, an attempt was made to disrupt the lpla1 gene by single homologous recombination:

The b3D.DT∧H.∧D-based knockout construct for single homologous recombination in P. berghei encompasses a 1014 bp PbLplA1 fragment corresponding to nucleotides 88 to 1098 (lacking the last 147 bp) which was amplified using the oligonucleotides Pb-3 and Pb-4 (BamHI 5′-GCGCGGATCCCAAAATATTTACTTTAATTTATCGTTGG-3′; SacII 5′-GCGCCCGCGGTTAGTCTAATGCATCTGAAAAAACATTTCC-3′). An artificial stop codon was introduced at the 3′ end of the PCR product. Transfection should result in the disruption of the gene locus and the formation of two incomplete and inactive copies of LplA1. The plasmid was digested with HpaI to linearise the vector before transfection into NK65 wild-type parasites. Three unsuccessful attempts to disrupt the gene with this construct are reported.
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1GCGCGGTACCTACATTATATTTAATATATAACAGGG
Additional information primer 1Pb-6 (KpnI); 5'
Sequence Primer 2GCGCAAGCTTCCAACGATAAATTAAAGTAAATATTTTG
Additional information primer 2Pb-7 (HindIII); 5'
Sequence Primer 3GCGCGCGGCCGCCCAATACTTTAAAACATTTAACAATC
Additional information primer 3Pb-8 (NotI); 3'
Sequence Primer 4GCGCCCGCGGGGACAAGCATAGCTTATGCCCGATC
Additional information primer 4Pb-9 (SacII); 3'
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6