Summary

RMgm-235
Malaria parasiteP. berghei
Genotype
DisruptedGene model (rodent): PBANKA_1037500; Gene model (P.falciparum): PF3D7_1411100; Gene product: conserved Plasmodium membrane protein, unknown function (Adenylyl cyclase α; ACα)
Phenotype Sporozoite; Liver stage;
Last modified: 24 April 2009, 09:14
  *RMgm-235
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene disruption
Reference (PubMed-PMID number) Reference 1 (PMID number) : 18389080
MR4 number
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone P. berghei ANKA cl15cy1
Other information parent line
The mutant parasite was generated by
Name PI/ResearcherT. Ono; A. Rodriguez
Name Group/DepartmentDepartment of Medical Parasitology
Name InstituteNew York University School of Medicine
CityNew York
CountryUSA
Name of the mutant parasite
RMgm numberRMgm-235
Principal nameacα- (C1 and C2)
Alternative nameacα-
Standardized name
Is the mutant parasite cloned after genetic modificationYes
Phenotype
Asexual blood stageNot different from wild type
Gametocyte/GameteNot different from wild type
Fertilization and ookineteNot different from wild type
OocystNot different from wild type
SporozoiteNormal numbers of salivary gland sporozoites are formed. Gliding motility of sporozoites was comparable to that of wild type parasites. The cell-traversal activity of mutant sporozoites was slightly lower, but not significantly different from wild type sporozoites.
The mutant sporozoites are approximately 50% less infective to Hepa1-6 cells and to C57Bl6 mice than wild type sporozoites.
Liver stageGliding motility of sporozoites was comparable to that of wild type parasites. The cell-traversal activity of mutant sporozoites was slightly lower, but not significantly different from wild type sporozoites.
The mutant sporozoites are approximately 50% less infective to Hepa1-6 cells and to C57Bl6 mice than wild type sporozoites.
Additional remarks phenotype

Mutant/mutation
The mutant lacks expression of  adenylyl cyclase 1(ACα)

Protein (function)
Two different genes with high homology to ACs (ACα and ACβ) have been identified in Plasmodium ( adenylyl cyclase beta: MAL8P1.150; PB000487.01.0) In particular, ACα was shown to have AC activity in P. falciparum. A genes from Plasmodium, Paramecium and Tetrahimena are closely related and their sequence includes a domain with high homology to K+ channels. In Paramecium, where the purified AC protein also has K+ channel activity, generation of cAMP is regulated by K+ conductance. It is thought that ACα presents a transmembrane K+-channel domain and an intracellular AC domain, which are functionally linked (Baker et al., 2004, IUBMB Life 56, 535-540).

Phenotype
In other studies evidence has been presented that suggest that migration through cells induces apical exocytosis in Plasmodium sporozoites, resulting in the exposure of adhesive domains of proteins (TRAP, SSP2) in the apical end of sporozoites, a process that may facilitate invasion of hepatocytes. Biochemical analyses indicate that regulated exocytosis was not activated in mutant sporozoites. Mutant sporozoites lacking expression of adenylyl cyclase, the enzyme that synthesizes cAMP, are not able to expose the adhesive proteins and their infectivity is reduced by half.

Additional information
Two P. falciparum gene models (PF14_0778, PF14_0043) and two P. berghei gene models (PB001333.02.0; PB106447.00.0) exist.

Biochemical analyses indicate that increases in cAMP levels in sporozoites mediate apical regulated exocytosis, which activates sporozoites for host cell invasion. By analysis of the mutant deficient in adenylyl cyclase α (ACα), evidence is presented that suggest that the cAMP signaling pathway is essential to induce apical exocytosis, which is activated during migration through cells.

To confirm that the phenotype observed in the mutant PbACα- sporozoites is caused specifically by depletion of the Pbacα gene, one of the PbACα- lines was complemented with ACα using a DNA construct with the human (h) dhfr selectable marker and two fragments of 4.3kb (5′) and 0.5 kb (3′) of the ACα gene of P. berghei. The linearized vector  integrates into the  acα locus. Selection of transformed parasites was performed by treating infected animals with WR99210 (20 mg/kg bodyweight)]. One parasite clone (Cmp) in which the acα gene was integrated into the acα locus was selected for analysis.

Other mutants


  Disrupted: Mutant parasite with a disrupted gene
Details of the target gene
Gene Model of Rodent Parasite PBANKA_1037500
Gene Model P. falciparum ortholog PF3D7_1411100
Gene productconserved Plasmodium membrane protein, unknown function
Gene product: Alternative nameAdenylyl cyclase α; ACα
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct usedPlasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid
Partial or complete disruption of the genePartial
Additional remarks partial/complete disruption It is thought that ACα presents a transmembrane K+-channel domain and an intracellular adenylyl cyclase (AC) domain, which are functionally linked. The disruption described here removes the AC domain but leaves part of the upstream sequence domain with high homology to K+-channel intact.
Selectable marker used to select the mutant parasitetgdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modification
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1AGCGCATTAGTTTATGATTTTTG
Additional information primer 1flG1F; 5' target
Sequence Primer 2TTGTGAATTAGGGATCTTCATGTC
Additional information primer 2flG1R; 5' target
Sequence Primer 3ATGCGCAAACCCGTTAAAT
Additional information primer 3flG2F; 3' target
Sequence Primer 4TTTGATTCATTCCACTTTCCA
Additional information primer 4flG2R; 3' target
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6