Summary

RMgm-231
Malaria parasiteP. berghei
Genotype
DisruptedGene model (rodent): PBANKA_1432200; Gene model (P.falciparum): PF3D7_1216500; Gene product: male development gene 1 | protein of early gametocyte 3 (MDV-1; PEG3; MDV-1/PEG3)
Phenotype Gametocyte/Gamete; Fertilization and ookinete; Oocyst; Sporozoite;
Last modified: 27 May 2009, 09:02
  *RMgm-231
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene disruption
Reference (PubMed-PMID number) Reference 1 (PMID number) : 19136003
MR4 number
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone P. berghei ANKA 2.34
Other information parent lineP. berghei ANKA 2.34 is a cloned, gametocyte producer line of the ANKA strain (PubMed: PMID: 15137943).
The mutant parasite was generated by
Name PI/ResearcherK. Lal; R.E. Sinden
Name Group/DepartmentThe Division of Cell and Molecular Biology
Name InstituteImperial College London
CityLondon
CountryUK
Name of the mutant parasite
RMgm numberRMgm-231
Principal name∆mdv-1
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
Phenotype
Asexual blood stageNot different from wild type
Gametocyte/GameteNormal or slightly reduced gametocyte production. The ratio male to female gametocytes in the mutant is comparable to that in wild type. The proportion of macrogametes which activate to express Pb28 on the surface is significantly reduced (27% of wild-type). Slightly reduced male gametocyte exflagellation.
Fertilization and ookineteStrongly reduced ookinete production (11-17% of wild type).
OocystStrongly reduced oocyst formation (10% of wild type numbers).
SporozoiteStrongly reduced sporozoite production (28% of wild type numbers). Sporozoites were infective to mice.
Liver stageNot different from wild type
Additional remarks phenotype

Mutant/mutation
The mutant lacks expression of MDV-1/PEG3.

Protein (function)
The protein is a gametocyte specific protein and has been named in P. falciparum MDV-1 (male development gene 1) or PEG3. In P. falciparum gametocytes the protein is associated with the osmiophilic bodies, the parasite membrane and all membranous compartments derived from the parasitophorous vacuole membrane. P. falciparum parasites lacking expression of MDV-1/PEG3 were affected in their capacity to produce functional gametocytes, which were unable to be transmitted through mosquitoes.

Phenotype
The phenotype analyses indicate a role of MDV during gamete formation, fertilisation and ookinete development.

Additional information
Analyses of protein localisation using IFA indicate a osmiophilic body location of MDV-1/PEG3 in both male and female gametocytes. MDV-1/PEG3 was also observed in  zygotes and ookinetes.

Independent mutants lacking expression of MDV-1/PEG3 has been described (RMgm-282, RMgm-283) which showed a slightly different phenotype. The phenotype analyses of these mutants indicate that the lack of expression of MDV-1/PEG3 strongly impairs fertilisation and ookinete formation and that the decreased fertilisation rate results from a strongly reduced capacity of both male and female gametocytes/gametes to egress from their host erythrocytes. Evidence is presented  that MDV-1/PEG3 plays a role in disruption of the parasitophorous vacuole membrane (PVM) and the erythrocyte membrane.

Other mutants
RMgm-282: A mutant lacking expression of MDV-1/PEG3. This mutant expresses GFP in male gametocytes/gametes and RFP in female gametocytes/gametes/zygotes.
RMgm-283: A mutant lacking expression of MDV-1/PEG3.
RMgm-251: A mutant expressing GFP under the control of the MDV-1/PEG3 promoter.


  Disrupted: Mutant parasite with a disrupted gene
Details of the target gene
Gene Model of Rodent Parasite PBANKA_1432200
Gene Model P. falciparum ortholog PF3D7_1216500
Gene productmale development gene 1 | protein of early gametocyte 3
Gene product: Alternative nameMDV-1; PEG3; MDV-1/PEG3
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct usedPlasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid KpnI/BamHI
Partial or complete disruption of the geneComplete
Additional remarks partial/complete disruption
Selectable marker used to select the mutant parasitepbdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modification
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1ATATGGTACCCACATCTTTGATTTTAATAATAGAACATAGA
Additional information primer 1U1_up5pKpnI; 5'
Sequence Primer 2ATATAAGCTTAATTTTATATATTAAACGATAGCCCTAATG
Additional information primer 2U1_up3pH3; 5'
Sequence Primer 3ATATGAATTCGTGTATTTGCGCCAATATATGC
Additional information primer 3U1_down5pEcoRI; 3'
Sequence Primer 4ATATGGATCCTGTTTATAAACTAATATAATGGGGAGTTAC
Additional information primer 4U1_down3pBamHI; 3'
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6