Summary

RMgm-230
Malaria parasiteP. berghei
Genotype
DisruptedGene model (rodent): PBANKA_1442000; Gene model (P.falciparum): PF3D7_1227200; Gene product: potassium channel (Kch1)
Phenotype Asexual bloodstage; Gametocyte/Gamete; Fertilization and ookinete; Oocyst;
Last modified: 6 April 2009, 20:10
  *RMgm-230
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene disruption
Reference (PubMed-PMID number) Reference 1 (PMID number) : 18434537
MR4 number
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone P. berghei ANKA 2.34
Other information parent lineP. berghei ANKA 2.34 is a cloned, gametocyte producer line of the ANKA strain (PubMed: PMID: 15137943).
The mutant parasite was generated by
Name PI/ResearcherP. Ellekvist; N. Kumar
Name Group/DepartmentDepartment of Cellular and Molecular Medicine, Faculty of Health Sciences
Name InstituteUniversity of Copenhagen
CityCopenhagen
CountryDenmark
Name of the mutant parasite
RMgm numberRMgm-230
Principal namekch1-null
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
Phenotype
Asexual blood stageMice infected with mutant parasites rapidly progressed in parasitaemia from day 4. In contrast to wild type-infected mice, however, parasitaemia in mutant-infected mice leveled off at a plateau 9 days after infection, before approaching the parasitaemia of wild type-infected mice at day 14. This delay in parasitaemia was not statistically significant. Mutant-infected mice showed a slightly prolonged survival compared with wild type-infected mice.
Gametocyte/GameteNormal gametocyte production
Fertilization and ookineteNormal ookinete production.
OocystMosquitoes infected (81 of 89 dissected) with wild type parasites revealed a median oocyst number of 115 per mosquito (25 and 75 percentiles, oocyst numbers 37 and 251). Only two mosquitoes of 112 fed on mutant-infected mice had oocysts in their midguts, thus demonstrating a 98% reduction in the infectivity of mutant parasites during transmission through mosquitoes.
SporozoiteNot different from wild type
Liver stageNot different from wild type
Additional remarks phenotype

Mutant/mutation
The mutant lacks expression of  Kch1(K+ channel, potassium channel)

Protein (function)
K+ channels constitute the largest and most diverse of ion channel families and are involved in K+ transport, cell volume control, and regulation of membrane potential. Two putative K+ channel-encoding genes have been found in the P. falciparum genome

Phenotype
Physiological and functional studies with the mutant parasites suggest that Kch1  mediates K+ uptake in the blood stages. The phenotype analyses show that Kch1  is not essential for the blood stages. However, it is critical for the development of the mosquito midgut oocyst stage of the parasite.

Additional information
A marked reduction in the uptake of the K+ congener 86Rb+ was demonstrated in the blood stages of the mutant parasites.

Other mutants


  Disrupted: Mutant parasite with a disrupted gene
Details of the target gene
Gene Model of Rodent Parasite PBANKA_1442000
Gene Model P. falciparum ortholog PF3D7_1227200
Gene productpotassium channel
Gene product: Alternative nameKch1
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct usedPlasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid KpnI, NotI, and ScaI
Partial or complete disruption of the genePartial
Additional remarks partial/complete disruption The deduced six transmembrane domains of PbKch1, encoded by the core region were replaced by double crossover with the TgDHFR ORF.
Selectable marker used to select the mutant parasitetgdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modification
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1GGTACCGTAAGAAAGGCAATCAACC
Additional information primer 1B1.L.1548–66 (KpnI); 5'
Sequence Primer 2AAGCTTGTTATCTGTTTTTCTTTTATCG
Additional information primer 2B1.R.2032–11 (HindIII); 5'
Sequence Primer 3GGATCCGAATCCATATTTTTATTTACCC
Additional information primer 3B1.L.3149–70 (BamHI)
Sequence Primer 4GCGGCCGCTTGATCATCCTTTTCCC
Additional information primer 4B1.R.3602–3585 (NotI)
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6