Summary

RMgm-229
Malaria parasiteP. berghei
Genotype
DisruptedGene model (rodent): PBANKA_0925500; Gene model (P.falciparum): PF3D7_1122800; Gene product: calcium-dependent protein kinase 6 (CDPK6)
Phenotype Sporozoite; Liver stage;
Last modified: 21 December 2011, 14:47
  *RMgm-229
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene disruption
Reference (PubMed-PMID number) Reference 1 (PMID number) : 18005753
MR4 number
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone Not applicable
Other information parent line
The mutant parasite was generated by
Name PI/ResearcherA. Coppi, P. Sinnis
Name Group/DepartmentDepartment of Medical Parasitology
Name InstituteNew York University School of Medicine
CityNew York
CountryUSA
Name of the mutant parasite
RMgm numberRMgm-229
Principal nameCDPK-6 KO
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
Phenotype
Asexual blood stageNot tested
Gametocyte/GameteNot tested
Fertilization and ookineteNot tested
OocystNot tested
SporozoiteMutant parasites produced fewer salivary gland sporozoites (no quantitative data is provided on oocyst production and on the reduction in sporozoite formation). Sporozoites displayed enhanced migratory activity and were significantly less infective for hepatocytes
Liver stageSporozoites displayed enhanced migratory activity and were significantly less infective for hepatocytes. In vivo there was significant delay in the time to detectable blood-stage infection with mutant sporozoites compared to wild type.
Additional remarks phenotype

Mutant/mutation
The mutant lacks expression of CDPK6

Protein (function)
CDPKs of Plasmodium belongs to an expanded family of Ca2+ dependent protein kinases (CDPKs). CDPKs combine an amino-terminal serine/threonine kinase domain and a carboxy-terminal calmodulin-like domain, composed of four EF hands, in the same molecule. In plants, CDPKs translate Ca2+ signals generated by external stimuli into cellular responses, thereby regulating cell division and differentiation, the development of tolerance to stress stimuli and the specific defense responses to pathogens.
According to the authors, CDPK6 should be grouped within the CDPK family of Plasmodium. CDPK-6 is predicted to encode an atypically large protein, characterized by a CDPK-like kinase domain, an incomplete carboxy-terminal calmodulin-like domain and an unusually large amino-terminal extension.

Phenotype
The phenotype analyses indicate that CDPK6 plays a role in sporozoite formation since fewer salivary gland sporozoites are produced. However, no quantitative data is provided on oocyst production and on the reduction in sporozoite formation. The phenotype analyses indicate that CDPK6 plays a role in invasion of hepatocytes.

Additional information
Mutant sporozoites displayed enhanced migratory activity and were significantly less infective for hepatocytes. Preincubation of  mutant sporozoites with soluble heparin could not enhance their invasive capacity. In vivo there was significant delay in the time to detectable blood-stage infection with mutant sporozoites compared to wild type. The majority of mutant sporozoites did not cleave CSP upon contact with hepatocytes. The results suggest that sporozoites after binding the hepatocytes undergoes activation via CDPK6 resulting in proteolysis of surface CSP. 

A second independent CDPK-6 mutant clone was generated using a two step PCR method as described in (Ecker A. et al., 2006). The primers used were K4pcr-1 TCCCATAAACTGTATTTTGTG; K4pcr-2 CGATCCGCGGGGGCCCAAGCTT GGCAATAACTCTAACACCATATCGTTAC; K4pcr-3 CGATGGGTACCCTCGAGGCTAGCGAGATTACATGTTGAGCACATTTTGA; K4pcr-4 AATATA GCGATGTGCTTTATAG.

Disruption of the P. falciparum ortholog has been succesful (Solyakov et al., 2011, Nat Commun, 2:565) indicating that this gene is not essential for asexual proliferation.

Other mutants


  Disrupted: Mutant parasite with a disrupted gene
Details of the target gene
Gene Model of Rodent Parasite PBANKA_0925500
Gene Model P. falciparum ortholog PF3D7_1122800
Gene productcalcium-dependent protein kinase 6
Gene product: Alternative nameCDPK6
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct usedPlasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid
Partial or complete disruption of the geneComplete
Additional remarks partial/complete disruption
Selectable marker used to select the mutant parasitetgdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modification
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1GGGGGGTACCGTCCCATAAACTGTATTTTGTG
Additional information primer 1370 bp of CDPK-6 5’ UTR was
cloned as a KpnI/ApaI fragment from genomic DNA
Sequence Primer 2GGGGGGGCCCCAATAACTCTAACACCATATCGTTAC
Additional information primer 2
Sequence Primer 3GGGGGGATCCGATTACATGTTGAGCACATTTTG
Additional information primer 3677 bp of CDPK-6 3’UTR was cloned as a BamHI/SacII fragment from genomic DNA
Sequence Primer 4GGGGCCGCGGACAATATAGCGATGTGCTTTATAG
Additional information primer 4
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6