Summary

RMgm-228
Malaria parasiteP. berghei
Genotype
DisruptedGene model (rodent): PBANKA_0414800; Gene model (P.falciparum): PF3D7_0906500; Gene product: arginase
Phenotype Asexual bloodstage;
Last modified: 28 June 2017, 18:17
  *RMgm-228
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene disruption
Reference (PubMed-PMID number) Reference 1 (PMID number) : 19218089
Reference 2 (PMID number) : 28642498
MR4 number
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone Not applicable
Other information parent line
The mutant parasite was generated by
Name PI/ResearcherK.L. Olszewski; M. Llinas
Name Group/DepartmentDepartment of Molecular Biology
Name InstitutePrinceton University
CityPrinceton
CountryUSA
Name of the mutant parasite
RMgm numberRMgm-228
Principal nameargKO
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
Phenotype
Asexual blood stageThe mutant exhibited a slight delay in ascending parasitemia in Balb/c mice, but mice infected with wild type and mutant parasites consistently developed comparably high blood parasitemias and exhibited no difference in the onset of morbidity.
Gametocyte/GameteNot tested
Fertilization and ookineteNot tested
OocystNot tested
SporozoiteNot tested
Liver stageNot tested
Additional remarks phenotype

Mutant/mutation
The mutant lacks expression of arginase.

Protein (function)
The protein shows high similarity to the metalloproteins arginase and agmatinase. A recombinant protein revealed strict specificity for arginine, and it has been proposed that its function in ornithine production is as a precursor for polyamine biosynthesis (Müller et al., 2005, Biol. Chem. 386, 117-26).  Extracellular arganine  is specifically converted by the parasite to ornithine.

Phenotype
The phenotype analyses indicate that arginase is not essential for asexual blood stage growth and multiplication. Mutant parasites did not convert arginine to ornithine. When blood stages were cultured ex vivo, wild type parasites exhibited high levels of ornithine generation, while ornithine generation by mutant parasites was indistinguishable from that of uninfected erythrocytes.

See also 28642498 and RMgm-4179 for a study using this mutant analysing liver stage development. Inthat study only liver stage development has been analysed. Evidence is presented that infectivity of part of the sporozoites is affected (see Additional Information in RMgm-4179)).

Additional information
A major metabolic activity of arginases in protozoa is the generation of ornithine for polyamine biosynthesis. However, this requirement seems unlikely to account for the high levels of observed activity of arginase in blood stages of Plasmodium because the vast majority of the metabolized arginine is excreted into the extracellular environment and not selectively retained in the cell. Moreover, the growth rate is not affected by the absence of arginine in the culture medium, suggesting that arginine is not rate-limiting for growth in vitro. The parasites lacking arginase presumably acquire sufficient amounts of ornithine either from the plasma or the activity of the host cell arginase.

Other mutants
RMgm-4179 - an independent mutant lacking expression of arginase


  Disrupted: Mutant parasite with a disrupted gene
Details of the target gene
Gene Model of Rodent Parasite PBANKA_0414800
Gene Model P. falciparum ortholog PF3D7_0906500
Gene productarginase
Gene product: Alternative name
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct used(Linear) plasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid
Partial or complete disruption of the geneComplete
Additional remarks partial/complete disruption
Selectable marker used to select the mutant parasitetgdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modification
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 15’-CCTTGG GGGCCC

5’-CCTTGGGGGCCCAAAGCAAAACAAGCAACCAAA-3’
Additional information primer 1forward primer (ApaI). The 5’ flanking region consisted of a 848 bp fragment starting 742 bp upstream of the ATG start and extending 106 bp into the coding region
Sequence Primer 25’- GGTTCC AAGCTTGCTAAGGGATTGACCAGCAG
Additional information primer 2reverse primer (HindIII)
Sequence Primer 3CCTTGG TCTAGA TGCCAGAGTTCTAGGCAATG
Additional information primer 3forward primer (XbaI). the 3’ flanking region consisted of a 574 bp fragment starting 31 bp upstream of the stop codon and extending 543 bp downstream.
Sequence Primer 4GGTTCCCCGCGG TGTGATCCGCATAAAAACCA
Additional information primer 4reverse primer (SacII)
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6