Summary

RMgm-226
Malaria parasiteP. berghei
Genotype
Transgene
Transgene not Plasmodium: LacZ (β-Galactosidase)
Promoter: Gene model: PBANKA_0403200; Gene model (P.falciparum): PF3D7_0304600; Gene product: circumsporozoite (CS) protein (CSP)
3'UTR: Gene model: PBANKA_0719300; Gene product: bifunctional dihydrofolate reductase-thymidylate synthase, putative (dhfr/ts)
Insertion locus: Gene model: PBANKA_0403200; Gene product: circumsporozoite (CS) protein (CSP)
Phenotype Oocyst; Sporozoite; Liver stage;
Last modified: 11 August 2009, 09:47
  *RMgm-226
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Introduction of a transgene
Reference (PubMed-PMID number) Reference 1 (PMID number) : 16316690
MR4 number MRA-841
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei NK65
Name parent line/clone Not applicable
Other information parent line
The mutant parasite was generated by
Name PI/ResearcherS. Engelmann, K. Matuschewski
Name Group/DepartmentDepartment of Parasitology
Name InstituteHeidelberg University School of Medicine
CityHeidelberg
CountryGermany
Name of the mutant parasite
RMgm numberRMgm-226
Principal namePbBlue
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
Phenotype
Asexual blood stageNot different from wild type
Gametocyte/GameteNot different from wild type
Fertilization and ookineteNot different from wild type
OocystThe enzyme β-galactosidase was detected as a ~116 kDa protein in Western blots with extracts from oocyst.
Oocysts were readily visualized by X-Gal staining.
SporozoiteThe enzyme β-galactosidase was detected as a ~116 kDa protein in Western blots with extracts from salivary gland sporozoites.
Sporozoites were readily visualized by X-Gal staining, both in salivary glands and as individual sporozoites. Sporozoites could be visualised by X-Gal staining in subcutaneous tissue of mice after mosquito bite.
Liver stageIntracellular liver stages can be stained with X-Gal.
Additional remarks phenotype

Mutant/mutation
The mutant expresses the reporter protein β-Galactosidase under the control of the CSP promoter.

Protein (function)
The ability of E. coli β-galactosidase to hydrolyze β-D-galactopyranoside analogs, such as X-Gal, CPRG, or MUG, allows reliable quantification of reporter enzyme expression over a wide range using simple colorimetric assays.

Phenotype
Phenotype analyses indicate that expression of β-galactosidase does not affect the viability and infectivity of sporozoites. Oocysts and sporozoites express β-galactosidase. Expression of β-galactosidase can be visualised and quantified using simple enzymatic assays. Sporozoite loads can be quantified using the β-D-galactopyranoside analog CPRG. Liver stage loads could be quantified using two sensitive methods, the substrate MUG and a β-galactosidase ELISA.

Additional information
A monoclonal anti-β-Galactosidase antibody from Promega was used.

X-gal staining was performed on fixed sporozoites. Sporozoites were immobilised and permeabilized for 10 min at room temperature with 2% formaldehyde, 0.2% glutaraldehyde, 0.02% Triton-X 100 in phosphate buffered saline (PBS). After washing with PBS the parasites were incubated with staining solution (5 mM potassium ferricyanid, 5 mM potassium ferrcyanid, 0.04% deoxycholate, 2 mM magnesium chloride in phosphate buffered saline) containing 1 mg ml−1 X-Gal until appearance of staining.

Different quantitative β-Gal assays were used to determine levels of β-Galactosidase in sporozoites and liver stages.

Other mutants


  Transgene: Mutant parasite expressing a transgene
Type and details of transgene
Is the transgene Plasmodium derived Transgene: not Plasmodium
Transgene nameLacZ (β-Galactosidase)
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/constructPlasmid single cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid Acc651
Selectable marker used to select the mutant parasitetgdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modificationThe reporter gene lacZ was amplified from a vector containing the lacZ gene (pNeoβGal, Stratagene) using primers LacZfor (5′-CGCGGATCCAAAATGGCA-CTGGCCGTCGTTTTACAACGTCG-3′, BamHI site is underlined) and LacZrev (5′-GGAAGATCTCCCCTGCCCGGTT-ATTATTATTTTTGAC-3′, BglII site is underlined).
Additional remarks selection procedure
Other details transgene
Promoter
Gene Model of Parasite PBANKA_0403200
Gene Model P. falciparum ortholog PF3D7_0304600
Gene productcircumsporozoite (CS) protein
Gene product: Alternative nameCSP
Primer information details of the primers used for amplification of the promoter sequence  Click to view information
Primer information details of the primers used for amplification of the promoter sequence  Click to hide information
Sequence Primer 1CCGGAATTCACATAAAAGGGAATATGGAATATACTAGC
Additional information primer 1p5′CSfor (EcoRI)
Sequence Primer 2CGCGGATCCAAATATATGCGTGTATATATAGATTTTG
Additional information primer 2p5′CSrev (BamHI)
3'-UTR
Gene Model of Parasite PBANKA_0719300
Gene productbifunctional dihydrofolate reductase-thymidylate synthase, putative
Gene product: Alternative namedhfr/ts
Primer information details of the primers used for amplification the 3'-UTR sequences  Click to view information
Primer information details of the primers used for amplification the 3'-UTR sequences  Click to hide information
Sequence Primer 1TGCTCTAGACGTTTTTCTTACTTATATAT
Additional information primer 1SEb3Dfor (XbaI)
Sequence Primer 2TCCCCGCGGCGGTGTGAAATACCGCACAGA
Additional information primer 2SEb3Drev (SacII)
Insertion/Replacement locus
Replacement / InsertionInsertion locus
Gene Model of Parasite PBANKA_0403200
Gene productcircumsporozoite (CS) protein
Gene product: Alternative nameCSP
Primer information details of the primers used for amplification of the target sequences  Click to view information
Primer information details of the primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1CCGGAATTCACATAAAAGGGAATATGGAATATACTAGC
Additional information primer 1p5′CSfor (EcoRI)
Sequence Primer 2CGCGGATCCAAATATATGCGTGTATATATAGATTTTG
Additional information primer 2p5′CSrev (BamHI)
Sequence Primer 3
Additional information primer 3
Sequence Primer 4
Additional information primer 4