Summary

RMgm-222
Malaria parasiteP. berghei
Genotype
Transgene
Transgene Plasmodium: Gene model: PVP01_0616100; Gene model (P.falciparum): PF3D7_1031000; Gene product: ookinete surface protein P25 (Pv25; P25)
Promoter: Gene model: PBANKA_0515000; Gene model (P.falciparum): PF3D7_1031000; Gene product: ookinete surface protein P25 (Pbs25; P25)
3'UTR: Gene model: PBANKA_0515000; Gene product: 25 kDa ookinete surface antigen precursor (25 kDa ookinete surface Pbs25; P25)
Replacement locus: Gene model: PBANKA_0515000; Gene product: 25 kDa ookinete surface antigen precursor (Pbs25; P25)
Phenotype Gametocyte/Gamete; Fertilization and ookinete;
Last modified: 2 November 2016, 10:55
  *RMgm-222
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Introduction of a transgene
Reference (PubMed-PMID number) Reference 1 (PMID number) : 17049690
MR4 number MRA-904
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone P. berghei ANKA cl15cy1
Other information parent lineA reference wild type clone from the ANKA strain of P. berghei (PubMed: PMID: 17406255).
The mutant parasite was generated by
Name PI/ResearcherS. Ramjanee, C.J. Janse, R.E. Sinden
Name Group/DepartmentDivision of Cell and Molecular Biology
Name InstituteImperial College London
CityLondon
CountryUK
Name of the mutant parasite
RMgm numberRMgm-222
Principal namePv25DR
Alternative name296 (Leiden)
Standardized name
Is the mutant parasite cloned after genetic modificationYes
Phenotype
Asexual blood stageNot different from wild type
Gametocyte/GameteGametocytes transcribe the transgene pv25. However, the protein is not produced in this stage as the result of translational repression of the transcripts in the gametocyte stage. The protein is only expressed after induction of gamete formation in female gametes, zygotes and ookinetes.
Fertilization and ookineteExpression of Pv25 in female gametes, zygotes and ookinetes. The protein is located on the surface of ookinetes. The protein is not evenly distributed over the parasite surface, but is mainly located at one pole of the ookinete.
OocystNot tested
SporozoiteNot tested
Liver stageNot tested
Additional remarks phenotype

Mutant/mutation
The mutant expresses the ookinete surface protein P25 of P. vivax (Pv25). Pv25 is under the control of the 5'-UTR and 3'-UTR regulatory regions p25 of P. berghei. The pv25 gene is introduced in the p25-p28 locus of P. berghei, thereby disrupting both p25 and p28 which encode two major ookinete surface proteins of P. berghei.

Protein (function)
P25 is one of two major surface proteins (P25 and P28) of the plasma membrane of ookinetes. The proteins are conserved between different Plasmodium species. The proteins are characterized by a secretory N-terminal signal sequence followed by three or four epidermal growth factor (EGF) domains and a glycosylphosphatidylinositol (GPI) anchor. Synthesis of both proteins begins between 0.5 and 2 h after the formation of the female gametes, and the proteins are still present in young oocysts. The paralogous genes encoding P25 and P28 are located next to each other in the genome in a head to tail organization. Antibodies against P25 prevent the formation of oocysts in the mosquito and thereby block transmission of the parasite.
Recombinant Histidine-tagged P25 of P. vivax (Pvs25) expressed in yeast (Pvs25H) has been tested in humans in phase I clinical trials and induces antibodies that blocked transmission significantly (up to 80% reduction in oocyst intensity and a 20–30% reduction in prevalence of infection).

Phenotype
Expression of Pv25 in female gametes, zygotes and ookinetes. The protein is located on the surface of ookinetes. The protein is not evenly distributed over the parasite surface, but is mainly located at one pole of the ookinete.

Additional information
The transgenic parasites Pv25DR and Pv25DR3 (RMgm-123) has been used to develop assays to determine transmission blocking activity (TBA) of sera against P25 of P. vivax.. It was shown that oocyst development of the transgenic parasites is inhibited by monoclonal antibody against Pv25 with the same kinetics exhibited by wild type parasites when exposed to mouse monoclonal antibodies targeted to a paralogous protein P28. Human transmission-blocking sera from a clinical vaccine trial of Pv25 inhibited oocyst development of Pv25DR and Pv25DR3, whereas non-blocking sera did not. It was shown that  transmission-blocking activity can be determined in a simple assays of ookinete development in vitro, assays that obviate the need for mosquito colonies. These results demonstrate that transgenic rodent malarias expressing proteins from human Plasmodium species can be cheap, safe, and simple tools for testing TBA from sera.

Other mutants
RMgm-223: Another mutant expressing a hybrid protein of P25 of P. vivax and P25 of P. berghei (line Pv25DR3). This mutant was generated using a construct that contains a 0.9 kb 5′ UTR of pb25, a truncated pvs25 gene together with the GPI addition sequence of pb25, it's 3′ UTR and the entire (1.6 kb) intergenic region between pb25 and pb28 ORFs. In this mutant the Pv25 protein is also located on the surface of ookinetes. In contrast to mutant Pv25DR described here, the protein is evenly distributed over the ookinete surface.
RMgm-273: A P. berghei transgenic mutant expressing P25 of P.falciparum


  Transgene: Mutant parasite expressing a transgene
Type and details of transgene
Is the transgene Plasmodium derived Transgene: Plasmodium
Gene Model of Parasite PVP01_0616100
Gene Model P. falciparum ortholog PF3D7_1031000
Gene productookinete surface protein P25
Gene product: Alternative namePv25; P25
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct(Linear) plasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid KpnI, XbaI, PvuI
Selectable marker used to select the mutant parasitetgdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modificationIn Pv25DR both endogenous p25 and p28 genes of P. berghei are disrupted and replaced with pv25 under the control of the 5′ and 3′ UTRs of P. berghei pb25.
In P. berghei, pb25 and pb28 are located on chromosome 5 in a head-to-tail orientation separated by only 1.4 kb of intergenic sequence. The contiguity of these genes permits disruption of both using a single DNA vector

The replacement plasmid, pPv25DR, contains the entire ORF of pv25 flanked by 1.1 kb of the 5′ and 0.35 kb of the 3′ UTR of P. berghei pb25. In addition it contains 5'-UTR sequences of pb25 and 3'-UTR sequences of pb28 as target sequences for integration into the genome by homologous recombination.

The pvs25 gene was cloned as a NcoI/EcoRI fragment using primers RS032 (5′-CATGCCATGGATGAACTCCTACTACAGCCTC-3′) and RS033 (5′-CCGGAATTCTTATATGACGTACGAAAGGACAA-3′).
Additional remarks selection procedure
Other details transgene
Promoter
Gene Model of Parasite PBANKA_0515000
Gene Model P. falciparum ortholog PF3D7_1031000
Gene productookinete surface protein P25
Gene product: Alternative namePbs25; P25
Primer information details of the primers used for amplification of the promoter sequence  Click to view information
Primer information details of the primers used for amplification of the promoter sequence  Click to hide information
Sequence Primer 1CGGGGTACCACTAGTGAGGAAATAAAATATAACGATAAC
Additional information primer 1L707 (Asp718)
Sequence Primer 2GGGGATATCCCATGGTTTTAAATAAATTTAAACGAATAAC
Additional information primer 2L708 (EcoRV)
3'-UTR
Gene Model of Parasite PBANKA_0515000
Gene product25 kDa ookinete surface antigen precursor
Gene product: Alternative name25 kDa ookinete surface Pbs25; P25
Primer information details of the primers used for amplification the 3'-UTR sequences  Click to view information
Primer information details of the primers used for amplification the 3'-UTR sequences  Click to hide information
Sequence Primer 1CCGGAATTCATAAACAAATATACCTGG
Additional information primer 1L711 (EcoRI)
Sequence Primer 2CGCGGATCCCCATTTGTGCATGCTTC
Additional information primer 2L712 (BamHI)
Insertion/Replacement locus
Replacement / InsertionReplacement locus
Gene Model of Parasite PBANKA_0515000
Gene product25 kDa ookinete surface antigen precursor
Gene product: Alternative namePbs25; P25
Primer information details of the primers used for amplification of the target sequences  Click to view information
Primer information details of the primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1CGGGGTACCACTAGTGAGGAAATAAAATATAACGATAAC
Additional information primer 1L707 (Asp718); Pb25 5'UTR
Sequence Primer 2GGGGATATCCCATGGTTTTAAATAAATTTAAACGAATAAC
Additional information primer 2L708 (EcoRV); Pb25 5'UTR
Sequence Primer 3CTCCCCCGGGATCGATTATATTCAATTGTTATCGC
Additional information primer 3L709 (SmaI); Pb28 3'UTR
Sequence Primer 4GCTCTAGAACAGCAACCGGCATAATCC
Additional information primer 4L710 (XbaI); Pb28 3'UTR